Mutagenetix > Incidental Mutations

Incidental Mutation 'R1371:Ndst1'

157344

Institutional Source

Beutler Lab

Gene Symbol

Ndst1

Ensembl Gene

ENSMUSG00000054008

Gene Name

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1

Synonyms

glucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik

MMRRC Submission

039435-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1371 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60685978-60713389 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 60707647 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 321 (I321T)

Ref Sequence

ENSEMBL: ENSMUSP00000126623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169273]

AlphaFold

Q3UHN9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169273
AA Change: I321T

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: I321T

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
Pfam:HSNSD	25	515	5.1e-254	PFAM
Pfam:Sulfotransfer_1	604	869	2.2e-48	PFAM

Meta Mutation Damage Score

0.9095

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.7%
20x: 89.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	A	11: 109,953,553	D884V	probably damaging	Het
Acvr2a	C	T	2: 48,899,616	T457M	probably damaging	Het
Akr1b10	C	T	6: 34,392,459	T208I	probably benign	Het
Aldh16a1	G	T	7: 45,147,250	T275K	possibly damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Asgr1	T	G	11: 70,056,097	C56W	probably benign	Het
Atp11b	T	C	3: 35,806,769	I335T	probably damaging	Het
BC061237	A	G	14: 44,504,305		probably benign	Het
Bdh1	G	T	16: 31,456,902	K280N	probably benign	Het
Bmp1	C	T	14: 70,492,466	C466Y	probably damaging	Het
Ccdc181	A	G	1: 164,280,603	E285G	probably benign	Het
Ces1f	C	T	8: 93,279,649	G18R	probably damaging	Het
Cfap43	T	A	19: 47,835,606	I109L	possibly damaging	Het
Cma2	T	C	14: 55,972,826	L56S	probably damaging	Het
Edc4	A	G	8: 105,890,750		probably benign	Het
F3	T	C	3: 121,732,510	C241R	probably damaging	Het
Fhdc1	T	A	3: 84,445,003	S972C	probably damaging	Het
H2afy2	A	T	10: 61,749,333	D177E	possibly damaging	Het
Heatr1	T	G	13: 12,417,632	I1086R	possibly damaging	Het
Hsh2d	A	T	8: 72,196,894		probably benign	Het
Ice1	T	C	13: 70,596,221	Y2081C	probably damaging	Het
Il1rl1	A	G	1: 40,442,713	N194D	probably damaging	Het
Ip6k1	G	A	9: 108,045,823	V385M	probably damaging	Het
Lig1	G	A	7: 13,288,685	R147Q	probably damaging	Het
Lrp1b	C	T	2: 40,647,153	V41I	probably damaging	Het
Mst1r	T	A	9: 107,917,225	V1201E	probably damaging	Het
Myof	T	C	19: 37,903,668		probably benign	Het
Nbas	G	T	12: 13,482,378		probably benign	Het
Nek10	G	A	14: 14,850,983	G343R	probably damaging	Het
Olfr13	A	T	6: 43,174,300	T105S	probably benign	Het
Olfr1385	T	A	11: 49,494,823	C97S	probably damaging	Het
Olfr462	A	T	11: 87,889,296	I200N	probably damaging	Het
Pde4d	T	C	13: 109,117,061	S141P	probably benign	Het
Pigm	A	T	1: 172,376,814	Q39L	probably damaging	Het
Prl7a2	T	A	13: 27,662,767	I88F	probably benign	Het
Prss16	T	A	13: 22,008,686		probably benign	Het
Psmc4	G	A	7: 28,042,797		probably benign	Het
Ptger3	T	A	3: 157,567,728	C237*	probably null	Het
Recql	G	A	6: 142,372,875	T214M	probably damaging	Het
Rfx7	T	A	9: 72,619,575	V1349D	probably damaging	Het
Ros1	A	G	10: 52,087,945	S1740P	probably damaging	Het
Rrm2b	A	T	15: 37,946,809	S83T	probably benign	Het
Sall4	A	G	2: 168,756,474	Y149H	probably benign	Het
Smad1	A	G	8: 79,349,578		probably benign	Het
Snrnp70	T	C	7: 45,380,705		probably benign	Het
Spef2	C	A	15: 9,725,108		probably benign	Het
Sptlc1	T	C	13: 53,351,624	T253A	probably benign	Het
Zbbx	T	C	3: 75,052,477	Y595C	possibly damaging	Het
Zfp382	T	C	7: 30,133,689	V255A	probably benign	Het

Other mutations in Ndst1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Ndst1	APN	18	60707956	missense	probably damaging	1.00
IGL01410:Ndst1	APN	18	60700445	missense	probably damaging	1.00
IGL01578:Ndst1	APN	18	60713126	missense	probably damaging	1.00
IGL02133:Ndst1	APN	18	60699546	missense	probably benign	0.05
IGL03200:Ndst1	APN	18	60699539	missense	possibly damaging	0.86
R0631:Ndst1	UTSW	18	60700359	splice site	probably benign
R0899:Ndst1	UTSW	18	60707882	missense	probably benign	0.00
R1104:Ndst1	UTSW	18	60697146	missense	probably damaging	0.98
R1456:Ndst1	UTSW	18	60713205	missense	possibly damaging	0.73
R1511:Ndst1	UTSW	18	60697170	missense	possibly damaging	0.61
R1524:Ndst1	UTSW	18	60698504	missense	probably damaging	0.99
R1699:Ndst1	UTSW	18	60695508	missense	probably damaging	1.00
R1718:Ndst1	UTSW	18	60707803	missense	probably damaging	0.99
R1772:Ndst1	UTSW	18	60702837	missense	probably damaging	0.99
R1900:Ndst1	UTSW	18	60712721	critical splice donor site	probably null
R2079:Ndst1	UTSW	18	60695509	missense	probably damaging	1.00
R2105:Ndst1	UTSW	18	60691253	missense	probably benign	0.01
R2127:Ndst1	UTSW	18	60691208	missense	probably benign	0.00
R2875:Ndst1	UTSW	18	60690047	missense	probably damaging	1.00
R3798:Ndst1	UTSW	18	60713166	missense	possibly damaging	0.94
R3950:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3951:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3952:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R4868:Ndst1	UTSW	18	60695476	missense	probably benign	0.07
R4898:Ndst1	UTSW	18	60691987	missense	probably benign	0.12
R4988:Ndst1	UTSW	18	60702933	missense	probably damaging	0.99
R5271:Ndst1	UTSW	18	60705132	missense	probably benign	0.03
R5337:Ndst1	UTSW	18	60690007	missense	probably damaging	1.00
R5467:Ndst1	UTSW	18	60692021	missense	probably benign
R5830:Ndst1	UTSW	18	60703838	missense	probably damaging	1.00
R5968:Ndst1	UTSW	18	60713076	missense	probably benign
R6241:Ndst1	UTSW	18	60703829	missense	probably damaging	0.99
R6422:Ndst1	UTSW	18	60702953	missense	probably benign	0.44
R7099:Ndst1	UTSW	18	60695500	missense	possibly damaging	0.88
R7544:Ndst1	UTSW	18	60697184	missense	probably damaging	1.00
R8918:Ndst1	UTSW	18	60692011	missense	probably benign	0.00
R8951:Ndst1	UTSW	18	60697124	missense	probably benign
R9187:Ndst1	UTSW	18	60691196	missense	probably benign	0.03
R9374:Ndst1	UTSW	18	60712859	missense	probably damaging	0.97
V8831:Ndst1	UTSW	18	60702927	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCCAATTACAACCCTTGCCAGATTC -3'
(R):5'- GACTGTGTTCCAGTCCAACCATTCTAC -3'

Sequencing Primer
(F):5'- TTCCTCCTGAATTCCAGAATACAC -3'
(R):5'- TTCTACCTACGAACCAGTGC -3'

Posted On

2014-02-18