Incidental Mutation 'R1371:Ndst1'
ID157344
Institutional Source Beutler Lab
Gene Symbol Ndst1
Ensembl Gene ENSMUSG00000054008
Gene NameN-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Synonymsglucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik
MMRRC Submission 039435-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1371 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location60685978-60713389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60707647 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 321 (I321T)
Ref Sequence ENSEMBL: ENSMUSP00000126623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169273]
Predicted Effect possibly damaging
Transcript: ENSMUST00000169273
AA Change: I321T

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: I321T

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:HSNSD 25 515 5.1e-254 PFAM
Pfam:Sulfotransfer_1 604 869 2.2e-48 PFAM
Meta Mutation Damage Score 0.9095 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 89.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,553 D884V probably damaging Het
Acvr2a C T 2: 48,899,616 T457M probably damaging Het
Akr1b10 C T 6: 34,392,459 T208I probably benign Het
Aldh16a1 G T 7: 45,147,250 T275K possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asgr1 T G 11: 70,056,097 C56W probably benign Het
Atp11b T C 3: 35,806,769 I335T probably damaging Het
BC061237 A G 14: 44,504,305 probably benign Het
Bdh1 G T 16: 31,456,902 K280N probably benign Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Ccdc181 A G 1: 164,280,603 E285G probably benign Het
Ces1f C T 8: 93,279,649 G18R probably damaging Het
Cfap43 T A 19: 47,835,606 I109L possibly damaging Het
Cma2 T C 14: 55,972,826 L56S probably damaging Het
Edc4 A G 8: 105,890,750 probably benign Het
F3 T C 3: 121,732,510 C241R probably damaging Het
Fhdc1 T A 3: 84,445,003 S972C probably damaging Het
H2afy2 A T 10: 61,749,333 D177E possibly damaging Het
Heatr1 T G 13: 12,417,632 I1086R possibly damaging Het
Hsh2d A T 8: 72,196,894 probably benign Het
Ice1 T C 13: 70,596,221 Y2081C probably damaging Het
Il1rl1 A G 1: 40,442,713 N194D probably damaging Het
Ip6k1 G A 9: 108,045,823 V385M probably damaging Het
Lig1 G A 7: 13,288,685 R147Q probably damaging Het
Lrp1b C T 2: 40,647,153 V41I probably damaging Het
Mst1r T A 9: 107,917,225 V1201E probably damaging Het
Myof T C 19: 37,903,668 probably benign Het
Nbas G T 12: 13,482,378 probably benign Het
Nek10 G A 14: 14,850,983 G343R probably damaging Het
Olfr13 A T 6: 43,174,300 T105S probably benign Het
Olfr1385 T A 11: 49,494,823 C97S probably damaging Het
Olfr462 A T 11: 87,889,296 I200N probably damaging Het
Pde4d T C 13: 109,117,061 S141P probably benign Het
Pigm A T 1: 172,376,814 Q39L probably damaging Het
Prl7a2 T A 13: 27,662,767 I88F probably benign Het
Prss16 T A 13: 22,008,686 probably benign Het
Psmc4 G A 7: 28,042,797 probably benign Het
Ptger3 T A 3: 157,567,728 C237* probably null Het
Recql G A 6: 142,372,875 T214M probably damaging Het
Rfx7 T A 9: 72,619,575 V1349D probably damaging Het
Ros1 A G 10: 52,087,945 S1740P probably damaging Het
Rrm2b A T 15: 37,946,809 S83T probably benign Het
Sall4 A G 2: 168,756,474 Y149H probably benign Het
Smad1 A G 8: 79,349,578 probably benign Het
Snrnp70 T C 7: 45,380,705 probably benign Het
Spef2 C A 15: 9,725,108 probably benign Het
Sptlc1 T C 13: 53,351,624 T253A probably benign Het
Zbbx T C 3: 75,052,477 Y595C possibly damaging Het
Zfp382 T C 7: 30,133,689 V255A probably benign Het
Other mutations in Ndst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ndst1 APN 18 60707956 missense probably damaging 1.00
IGL01410:Ndst1 APN 18 60700445 missense probably damaging 1.00
IGL01578:Ndst1 APN 18 60713126 missense probably damaging 1.00
IGL02133:Ndst1 APN 18 60699546 missense probably benign 0.05
IGL03200:Ndst1 APN 18 60699539 missense possibly damaging 0.86
R0631:Ndst1 UTSW 18 60700359 splice site probably benign
R0899:Ndst1 UTSW 18 60707882 missense probably benign 0.00
R1104:Ndst1 UTSW 18 60697146 missense probably damaging 0.98
R1456:Ndst1 UTSW 18 60713205 missense possibly damaging 0.73
R1511:Ndst1 UTSW 18 60697170 missense possibly damaging 0.61
R1524:Ndst1 UTSW 18 60698504 missense probably damaging 0.99
R1699:Ndst1 UTSW 18 60695508 missense probably damaging 1.00
R1718:Ndst1 UTSW 18 60707803 missense probably damaging 0.99
R1772:Ndst1 UTSW 18 60702837 missense probably damaging 0.99
R1900:Ndst1 UTSW 18 60712721 critical splice donor site probably null
R2079:Ndst1 UTSW 18 60695509 missense probably damaging 1.00
R2105:Ndst1 UTSW 18 60691253 missense probably benign 0.01
R2127:Ndst1 UTSW 18 60691208 missense probably benign 0.00
R2875:Ndst1 UTSW 18 60690047 missense probably damaging 1.00
R3798:Ndst1 UTSW 18 60713166 missense possibly damaging 0.94
R3950:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R3951:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R3952:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R4868:Ndst1 UTSW 18 60695476 missense probably benign 0.07
R4898:Ndst1 UTSW 18 60691987 missense probably benign 0.12
R4988:Ndst1 UTSW 18 60702933 missense probably damaging 0.99
R5271:Ndst1 UTSW 18 60705132 missense probably benign 0.03
R5337:Ndst1 UTSW 18 60690007 missense probably damaging 1.00
R5467:Ndst1 UTSW 18 60692021 missense probably benign
R5830:Ndst1 UTSW 18 60703838 missense probably damaging 1.00
R5968:Ndst1 UTSW 18 60713076 missense probably benign
R6241:Ndst1 UTSW 18 60703829 missense probably damaging 0.99
R6422:Ndst1 UTSW 18 60702953 missense probably benign 0.44
R7099:Ndst1 UTSW 18 60695500 missense possibly damaging 0.88
R7544:Ndst1 UTSW 18 60697184 missense probably damaging 1.00
V8831:Ndst1 UTSW 18 60702927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCAATTACAACCCTTGCCAGATTC -3'
(R):5'- GACTGTGTTCCAGTCCAACCATTCTAC -3'

Sequencing Primer
(F):5'- TTCCTCCTGAATTCCAGAATACAC -3'
(R):5'- TTCTACCTACGAACCAGTGC -3'
Posted On2014-02-18