Mutagenetix > Incidental Mutation

Incidental Mutation 'R1372:Cntnap5b'

157349

Institutional Source

Beutler Lab

Gene Symbol

Cntnap5b

Ensembl Gene

ENSMUSG00000067028

Gene Name

contactin associated protein-like 5B

Synonyms

Caspr5-2, C230078M14Rik

MMRRC Submission

039436-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R1372 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

99772765-100485942 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 100164088 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 499 (D499N)

Ref Sequence

ENSEMBL: ENSMUSP00000083944 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086738] [ENSMUST00000188735]

AlphaFold

Q0V8T8

Predicted Effect

probably benign
Transcript: ENSMUST00000086738
AA Change: D499N

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000083944
Gene: ENSMUSG00000067028
AA Change: D499N

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
FA58C	39	174	2.76e-16	SMART
LamG	201	338	2.84e-27	SMART
LamG	387	521	9.22e-27	SMART
EGF	549	583	1.14e0	SMART
Blast:FBG	586	758	3e-66	BLAST
LamG	798	925	2.12e-26	SMART
EGF	946	982	1.51e0	SMART
LamG	1023	1159	2.14e-13	SMART
transmembrane domain	1227	1249	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000188735
AA Change: D185N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000139877
Gene: ENSMUSG00000067028
AA Change: D185N

Domain	Start	End	E-Value	Type
LamG	73	207	5.9e-29	SMART
EGF	235	269	5.6e-3	SMART
Blast:FBG	272	402	2e-42	BLAST
LamG	415	554	2.5e-11	SMART
EGF	575	611	7.1e-3	SMART
LamG	652	788	1.4e-15	SMART
transmembrane domain	856	878	N/A	INTRINSIC

Meta Mutation Damage Score

0.0632

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030J22Rik	T	A	8: 116,971,957	Q137L	possibly damaging	Het
Abca12	A	G	1: 71,294,857	I1162T	probably damaging	Het
Adcy2	T	A	13: 68,668,533	N778I	probably damaging	Het
Adgre5	G	A	8: 83,728,320	P248S	probably damaging	Het
Akap13	G	A	7: 75,609,592	G655S	possibly damaging	Het
Ankrd28	A	T	14: 31,745,261	M248K	probably benign	Het
Asxl3	T	G	18: 22,410,009	S20A	probably benign	Het
Atf7ip2	G	A	16: 10,234,331	V225I	probably damaging	Het
Car10	A	T	11: 93,578,699	T167S	probably benign	Het
Cbx7	C	T	15: 79,918,873	G160R	probably damaging	Het
Ccdc151	C	T	9: 21,993,620	R290H	probably damaging	Het
Cd209d	C	A	8: 3,878,515		probably benign	Het
Cdca4	G	A	12: 112,821,917	Q64*	probably null	Het
Cela2a	C	T	4: 141,819,094	G178D	probably damaging	Het
Cox7a2	G	A	9: 79,758,537	R21*	probably null	Het
Crmp1	G	A	5: 37,288,811	G604R	probably benign	Het
Cul9	C	G	17: 46,522,175	A1326P	probably damaging	Het
Cxcr1	T	C	1: 74,192,002	D287G	probably benign	Het
Cyp4a12b	T	C	4: 115,432,949	I233T	probably benign	Het
Dlg1	T	C	16: 31,812,820	I208T	probably damaging	Het
Dsg4	C	A	18: 20,449,676		probably null	Het
Epha3	A	G	16: 63,611,053	I495T	possibly damaging	Het
Gm4778	A	G	3: 94,266,128	T148A	possibly damaging	Het
Hmcn1	A	T	1: 150,680,715	M2440K	probably benign	Het
Klb	G	C	5: 65,348,746	R112P	possibly damaging	Het
Leo1	T	C	9: 75,449,469	V377A	possibly damaging	Het
Lsg1	A	G	16: 30,564,654	F583L	possibly damaging	Het
Mphosph9	A	T	5: 124,283,745		probably null	Het
Mpp3	A	G	11: 102,000,575	V579A	probably damaging	Het
Oca2	T	A	7: 56,535,968	M814K	probably benign	Het
Pdgfra	A	G	5: 75,189,263	E936G	probably damaging	Het
Pkd1	T	C	17: 24,575,266	C1976R	probably damaging	Het
Plekhg5	G	A	4: 152,104,731	R243H	probably damaging	Het
Pogz	T	A	3: 94,860,888	L126M	probably damaging	Het
Rbm15	G	T	3: 107,332,630	R151S	possibly damaging	Het
Rec8	T	C	14: 55,618,974	Y68H	probably damaging	Het
Rhcg	A	T	7: 79,599,374	D366E	probably benign	Het
Ryr3	T	A	2: 112,834,201	S1582C	probably damaging	Het
Sh3pxd2a	A	T	19: 47,267,721	W853R	probably damaging	Het
Tnxb	T	C	17: 34,710,293	V2770A	possibly damaging	Het
Vmn2r63	A	G	7: 42,929,218	F84L	possibly damaging	Het

Other mutations in Cntnap5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Cntnap5b	APN	1	100050754	missense	probably damaging	1.00
IGL00477:Cntnap5b	APN	1	100213743	missense	probably damaging	0.97
IGL00505:Cntnap5b	APN	1	100379161	missense	possibly damaging	0.81
IGL00596:Cntnap5b	APN	1	100379161	missense	possibly damaging	0.81
IGL00846:Cntnap5b	APN	1	100164223	missense	probably damaging	1.00
IGL00895:Cntnap5b	APN	1	100383585	missense	probably damaging	0.98
IGL00948:Cntnap5b	APN	1	100141357	missense	probably benign	0.00
IGL01073:Cntnap5b	APN	1	100076030	missense	probably benign	0.08
IGL01523:Cntnap5b	APN	1	100431779	missense	probably benign	0.02
IGL01779:Cntnap5b	APN	1	99967339	missense	probably damaging	1.00
IGL02253:Cntnap5b	APN	1	100164211	missense	possibly damaging	0.75
IGL02628:Cntnap5b	APN	1	100072069	missense	probably damaging	0.97
R0166:Cntnap5b	UTSW	1	100274361	missense	probably benign	0.41
R0211:Cntnap5b	UTSW	1	100478374	missense	possibly damaging	0.82
R0281:Cntnap5b	UTSW	1	100072153	missense	probably benign	0.22
R0363:Cntnap5b	UTSW	1	100274468	missense	probably benign	0.01
R0514:Cntnap5b	UTSW	1	99772786	missense	probably benign
R0645:Cntnap5b	UTSW	1	100072042	splice site	probably benign
R0848:Cntnap5b	UTSW	1	100255163	missense	probably benign	0.22
R1006:Cntnap5b	UTSW	1	100383617	missense	probably benign	0.00
R1349:Cntnap5b	UTSW	1	100164088	missense	probably benign	0.09
R1474:Cntnap5b	UTSW	1	100072089	missense	probably benign	0.25
R1681:Cntnap5b	UTSW	1	100076107	missense	probably damaging	0.98
R1727:Cntnap5b	UTSW	1	100213744	missense	possibly damaging	0.91
R1760:Cntnap5b	UTSW	1	99772810	missense	probably benign	0.05
R1777:Cntnap5b	UTSW	1	100370078	missense	probably benign	0.10
R1939:Cntnap5b	UTSW	1	99967348	missense	probably benign
R1988:Cntnap5b	UTSW	1	100072140	missense	possibly damaging	0.92
R2069:Cntnap5b	UTSW	1	100358725	missense	probably benign	0.04
R2113:Cntnap5b	UTSW	1	100274415	missense	probably benign
R2148:Cntnap5b	UTSW	1	100383474	missense	probably benign	0.01
R2158:Cntnap5b	UTSW	1	100390572	missense	probably damaging	1.00
R2223:Cntnap5b	UTSW	1	100213687	missense	probably damaging	1.00
R2350:Cntnap5b	UTSW	1	100379126	missense	probably damaging	1.00
R3840:Cntnap5b	UTSW	1	100383477	missense	possibly damaging	0.50
R4329:Cntnap5b	UTSW	1	100072163	missense	probably damaging	0.99
R4609:Cntnap5b	UTSW	1	99772847	critical splice donor site	probably null
R4799:Cntnap5b	UTSW	1	100358725	missense	probably benign	0.04
R5129:Cntnap5b	UTSW	1	100379090	missense	probably damaging	1.00
R5323:Cntnap5b	UTSW	1	100383550	nonsense	probably null
R5434:Cntnap5b	UTSW	1	100072201	missense	probably benign	0.02
R5579:Cntnap5b	UTSW	1	100383395	nonsense	probably null
R5579:Cntnap5b	UTSW	1	100383399	missense	probably benign	0.27
R5630:Cntnap5b	UTSW	1	100072069	missense	probably damaging	0.99
R5644:Cntnap5b	UTSW	1	100383601	missense	probably benign	0.00
R5761:Cntnap5b	UTSW	1	100446894	missense	probably damaging	1.00
R6042:Cntnap5b	UTSW	1	100390592	missense	probably benign
R6147:Cntnap5b	UTSW	1	100050781	missense	probably damaging	1.00
R6190:Cntnap5b	UTSW	1	100379075	missense	possibly damaging	0.80
R6248:Cntnap5b	UTSW	1	100072102	missense	probably benign	0.30
R6286:Cntnap5b	UTSW	1	100255073	missense	possibly damaging	0.82
R6306:Cntnap5b	UTSW	1	100164146	missense	probably damaging	1.00
R6336:Cntnap5b	UTSW	1	100358669	missense	probably benign	0.00
R6360:Cntnap5b	UTSW	1	100431736	nonsense	probably null
R6722:Cntnap5b	UTSW	1	100478486	missense	probably damaging	0.98
R6750:Cntnap5b	UTSW	1	100274499	missense	probably damaging	1.00
R6806:Cntnap5b	UTSW	1	99940649	missense	probably damaging	1.00
R6933:Cntnap5b	UTSW	1	100383450	missense	probably benign	0.01
R6957:Cntnap5b	UTSW	1	100274472	missense	probably benign	0.08
R6958:Cntnap5b	UTSW	1	100274472	missense	probably benign	0.08
R6959:Cntnap5b	UTSW	1	100274472	missense	probably benign	0.08
R6961:Cntnap5b	UTSW	1	100274472	missense	probably benign	0.08
R6962:Cntnap5b	UTSW	1	100274472	missense	probably benign	0.08
R7088:Cntnap5b	UTSW	1	100160077	missense	probably damaging	0.99
R7146:Cntnap5b	UTSW	1	100050794	splice site	probably null
R7165:Cntnap5b	UTSW	1	100076162	missense	possibly damaging	0.94
R7190:Cntnap5b	UTSW	1	100431849	splice site	probably null
R7376:Cntnap5b	UTSW	1	99967269	missense	possibly damaging	0.92
R7385:Cntnap5b	UTSW	1	100379090	missense	probably damaging	1.00
R8053:Cntnap5b	UTSW	1	100390677	missense	probably damaging	0.98
R8080:Cntnap5b	UTSW	1	100072203	missense	probably benign	0.16
R8082:Cntnap5b	UTSW	1	100379216	missense	probably benign	0.00
R8271:Cntnap5b	UTSW	1	100072107	missense	probably benign	0.00
R8303:Cntnap5b	UTSW	1	100141297	missense	probably damaging	1.00
R8428:Cntnap5b	UTSW	1	100383585	missense	probably damaging	0.98
R9131:Cntnap5b	UTSW	1	100050643	missense	probably benign	0.22
R9144:Cntnap5b	UTSW	1	100050787	missense	probably damaging	1.00
R9522:Cntnap5b	UTSW	1	100484622	missense	probably benign	0.00
R9611:Cntnap5b	UTSW	1	99967210	missense	probably damaging	1.00
RF007:Cntnap5b	UTSW	1	100164070	missense	probably damaging	1.00
X0020:Cntnap5b	UTSW	1	100431848	critical splice donor site	probably null
Z1176:Cntnap5b	UTSW	1	99967270	missense	probably damaging	0.99
Z1176:Cntnap5b	UTSW	1	100164228	missense	possibly damaging	0.86
Z1176:Cntnap5b	UTSW	1	100446840	missense	probably benign	0.01
Z1177:Cntnap5b	UTSW	1	100050706	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- ACCTCCTCCTGAGCTAGGATTTACAAC -3'
(R):5'- GCTAGGACCAGCCATCTCCAATTGAG -3'

Sequencing Primer
(F):5'- CAACAAAAGTATTCCCTGCTGTG -3'
(R):5'- GGCAACTCAATTATATCTAATGTGGC -3'

Posted On

2014-02-18