Incidental Mutation 'R1372:Klb'
ID157359
Institutional Source Beutler Lab
Gene Symbol Klb
Ensembl Gene ENSMUSG00000029195
Gene Nameklotho beta
SynonymsbetaKlotho
MMRRC Submission 039436-MU
Accession Numbers

Genbank: NM_031180.2; Ensembl: ENSMUST00000031096;

MGI:1932466

Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R1372 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location65348314-65384007 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 65348746 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 112 (R112P)
Ref Sequence ENSEMBL: ENSMUSP00000145091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031096] [ENSMUST00000205084]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031096
AA Change: R112P

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031096
Gene: ENSMUSG00000029195
AA Change: R112P

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 77 385 8.8e-96 PFAM
Pfam:Glyco_hydro_1 374 506 1.7e-31 PFAM
Pfam:Glyco_hydro_1 515 965 6.3e-80 PFAM
transmembrane domain 995 1017 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203333
Predicted Effect possibly damaging
Transcript: ENSMUST00000205084
AA Change: R112P

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145091
Gene: ENSMUSG00000029195
AA Change: R112P

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 77 360 8.6e-94 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype Strain: 3587748
PHENOTYPE: Homozygous null mice display increased bile acid synthesis and excretion, resistance to gallstone formation, and slightly decreased body weight. Mice homozygous for a knock-out allele or a conditional allele activated in adipose tissue exhibit resistanceto FGF21-induced metabolic disruptions. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T A 8: 116,971,957 Q137L possibly damaging Het
Abca12 A G 1: 71,294,857 I1162T probably damaging Het
Adcy2 T A 13: 68,668,533 N778I probably damaging Het
Adgre5 G A 8: 83,728,320 P248S probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Ankrd28 A T 14: 31,745,261 M248K probably benign Het
Asxl3 T G 18: 22,410,009 S20A probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Car10 A T 11: 93,578,699 T167S probably benign Het
Cbx7 C T 15: 79,918,873 G160R probably damaging Het
Ccdc151 C T 9: 21,993,620 R290H probably damaging Het
Cd209d C A 8: 3,878,515 probably benign Het
Cdca4 G A 12: 112,821,917 Q64* probably null Het
Cela2a C T 4: 141,819,094 G178D probably damaging Het
Cntnap5b G A 1: 100,164,088 D499N probably benign Het
Cox7a2 G A 9: 79,758,537 R21* probably null Het
Crmp1 G A 5: 37,288,811 G604R probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Cxcr1 T C 1: 74,192,002 D287G probably benign Het
Cyp4a12b T C 4: 115,432,949 I233T probably benign Het
Dlg1 T C 16: 31,812,820 I208T probably damaging Het
Dsg4 C A 18: 20,449,676 probably null Het
Epha3 A G 16: 63,611,053 I495T possibly damaging Het
Gm4778 A G 3: 94,266,128 T148A possibly damaging Het
Hmcn1 A T 1: 150,680,715 M2440K probably benign Het
Leo1 T C 9: 75,449,469 V377A possibly damaging Het
Lsg1 A G 16: 30,564,654 F583L possibly damaging Het
Mphosph9 A T 5: 124,283,745 probably null Het
Mpp3 A G 11: 102,000,575 V579A probably damaging Het
Oca2 T A 7: 56,535,968 M814K probably benign Het
Pdgfra A G 5: 75,189,263 E936G probably damaging Het
Pkd1 T C 17: 24,575,266 C1976R probably damaging Het
Plekhg5 G A 4: 152,104,731 R243H probably damaging Het
Pogz T A 3: 94,860,888 L126M probably damaging Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Rec8 T C 14: 55,618,974 Y68H probably damaging Het
Rhcg A T 7: 79,599,374 D366E probably benign Het
Ryr3 T A 2: 112,834,201 S1582C probably damaging Het
Sh3pxd2a A T 19: 47,267,721 W853R probably damaging Het
Tnxb T C 17: 34,710,293 V2770A possibly damaging Het
Vmn2r63 A G 7: 42,929,218 F84L possibly damaging Het
Other mutations in Klb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Klb APN 5 65372374 missense possibly damaging 0.90
IGL00821:Klb APN 5 65372149 missense probably damaging 1.00
IGL01082:Klb APN 5 65375940 missense possibly damaging 0.71
IGL01637:Klb APN 5 65375679 critical splice acceptor site probably null
IGL02098:Klb APN 5 65379885 missense probably benign 0.21
IGL03113:Klb APN 5 65383470 missense probably benign 0.00
1mM(1):Klb UTSW 5 65348650 missense probably damaging 1.00
P0016:Klb UTSW 5 65379923 nonsense probably null
R0268:Klb UTSW 5 65348837 missense probably benign 0.02
R0383:Klb UTSW 5 65372499 intron probably null
R0676:Klb UTSW 5 65379055 missense probably damaging 1.00
R0735:Klb UTSW 5 65379727 missense probably benign
R0972:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1051:Klb UTSW 5 65379327 missense probably damaging 1.00
R1168:Klb UTSW 5 65378974 missense probably damaging 1.00
R1403:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1403:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1446:Klb UTSW 5 65348995 missense probably damaging 1.00
R1696:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1743:Klb UTSW 5 65375861 missense probably damaging 0.99
R1801:Klb UTSW 5 65349235 missense probably null 0.90
R1804:Klb UTSW 5 65379853 missense probably damaging 1.00
R1848:Klb UTSW 5 65348837 missense probably benign 0.02
R1967:Klb UTSW 5 65372074 missense probably damaging 0.98
R3420:Klb UTSW 5 65372142 missense probably damaging 1.00
R4397:Klb UTSW 5 65380039 missense probably damaging 1.00
R4490:Klb UTSW 5 65375794 missense probably benign 0.02
R4491:Klb UTSW 5 65375794 missense probably benign 0.02
R4547:Klb UTSW 5 65379928 missense probably benign 0.00
R4878:Klb UTSW 5 65348490 missense probably damaging 0.99
R5269:Klb UTSW 5 65348797 missense probably damaging 1.00
R5418:Klb UTSW 5 65383470 missense probably benign 0.00
R5453:Klb UTSW 5 65383385 missense probably benign 0.08
R5541:Klb UTSW 5 65379234 missense probably benign 0.27
R5672:Klb UTSW 5 65379949 missense possibly damaging 0.82
R5841:Klb UTSW 5 65379324 nonsense probably null
R6088:Klb UTSW 5 65349013 missense probably benign 0.07
R6807:Klb UTSW 5 65379534 missense probably damaging 1.00
R6955:Klb UTSW 5 65379088 nonsense probably null
R7068:Klb UTSW 5 65379340 missense probably damaging 1.00
R7284:Klb UTSW 5 65383478 missense probably benign 0.01
R7322:Klb UTSW 5 65383364 missense probably benign 0.44
R7346:Klb UTSW 5 65348631 nonsense probably null
R7366:Klb UTSW 5 65372431 missense probably damaging 1.00
Z1177:Klb UTSW 5 65348741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCTGCTGCGAGCTGTTACC -3'
(R):5'- TCCTAAGTACCAGCGAGTCCAGAAG -3'

Sequencing Primer
(F):5'- CGAGCTGTTACCGGCTTC -3'
(R):5'- GTAGTACCGGAGACCTTGC -3'
Posted On2014-02-18