Incidental Mutation 'R1372:Car10'
ID157374
Institutional Source Beutler Lab
Gene Symbol Car10
Ensembl Gene ENSMUSG00000056158
Gene Namecarbonic anhydrase 10
SynonymsCA-RP X, 2700029L05Rik
MMRRC Submission 039436-MU
Accession Numbers

Genbank: NM_028296; MGI: 1919855

Is this an essential gene? Possibly non essential (E-score: 0.410) question?
Stock #R1372 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location93098028-93601749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93578699 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 167 (T167S)
Ref Sequence ENSEMBL: ENSMUSP00000103495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042943] [ENSMUST00000107858] [ENSMUST00000107863]
Predicted Effect probably benign
Transcript: ENSMUST00000042943
AA Change: T167S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000035585
Gene: ENSMUSG00000056158
AA Change: T167S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Carb_anhydrase 33 301 2.25e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107858
AA Change: T143S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000103490
Gene: ENSMUSG00000056158
AA Change: T143S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Carb_anhydrase 33 277 2.21e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107863
AA Change: T167S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000103495
Gene: ENSMUSG00000056158
AA Change: T167S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Carb_anhydrase 33 301 2.25e-86 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the carbonic anhydrase family of zinc metalloenzymes, which catalyze the reversible hydration of carbon dioxide in various biological processes. The protein encoded by this gene is an acatalytic member of the alpha-carbonic anhydrase subgroup, and it is thought to play a role in the central nervous system, especially in brain development. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T A 8: 116,971,957 Q137L possibly damaging Het
Abca12 A G 1: 71,294,857 I1162T probably damaging Het
Adcy2 T A 13: 68,668,533 N778I probably damaging Het
Adgre5 G A 8: 83,728,320 P248S probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Ankrd28 A T 14: 31,745,261 M248K probably benign Het
Asxl3 T G 18: 22,410,009 S20A probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Cbx7 C T 15: 79,918,873 G160R probably damaging Het
Ccdc151 C T 9: 21,993,620 R290H probably damaging Het
Cd209d C A 8: 3,878,515 probably benign Het
Cdca4 G A 12: 112,821,917 Q64* probably null Het
Cela2a C T 4: 141,819,094 G178D probably damaging Het
Cntnap5b G A 1: 100,164,088 D499N probably benign Het
Cox7a2 G A 9: 79,758,537 R21* probably null Het
Crmp1 G A 5: 37,288,811 G604R probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Cxcr1 T C 1: 74,192,002 D287G probably benign Het
Cyp4a12b T C 4: 115,432,949 I233T probably benign Het
Dlg1 T C 16: 31,812,820 I208T probably damaging Het
Dsg4 C A 18: 20,449,676 probably null Het
Epha3 A G 16: 63,611,053 I495T possibly damaging Het
Gm4778 A G 3: 94,266,128 T148A possibly damaging Het
Hmcn1 A T 1: 150,680,715 M2440K probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Leo1 T C 9: 75,449,469 V377A possibly damaging Het
Lsg1 A G 16: 30,564,654 F583L possibly damaging Het
Mphosph9 A T 5: 124,283,745 probably null Het
Mpp3 A G 11: 102,000,575 V579A probably damaging Het
Oca2 T A 7: 56,535,968 M814K probably benign Het
Pdgfra A G 5: 75,189,263 E936G probably damaging Het
Pkd1 T C 17: 24,575,266 C1976R probably damaging Het
Plekhg5 G A 4: 152,104,731 R243H probably damaging Het
Pogz T A 3: 94,860,888 L126M probably damaging Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Rec8 T C 14: 55,618,974 Y68H probably damaging Het
Rhcg A T 7: 79,599,374 D366E probably benign Het
Ryr3 T A 2: 112,834,201 S1582C probably damaging Het
Sh3pxd2a A T 19: 47,267,721 W853R probably damaging Het
Tnxb T C 17: 34,710,293 V2770A possibly damaging Het
Vmn2r63 A G 7: 42,929,218 F84L possibly damaging Het
Other mutations in Car10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Car10 APN 11 93304657 splice site probably benign
IGL01077:Car10 APN 11 93597143 missense possibly damaging 0.54
IGL01099:Car10 APN 11 93578690 missense possibly damaging 0.91
IGL02810:Car10 APN 11 93578696 missense probably damaging 1.00
IGL03037:Car10 APN 11 93100218 utr 5 prime probably benign
IGL03061:Car10 APN 11 93490525 missense probably damaging 0.98
IGL03105:Car10 APN 11 93100275 missense probably benign 0.07
IGL03347:Car10 APN 11 93100296 splice site probably benign
IGL02837:Car10 UTSW 11 93597251 missense probably damaging 0.96
R0076:Car10 UTSW 11 93490597 missense possibly damaging 0.93
R0076:Car10 UTSW 11 93490597 missense possibly damaging 0.93
R0387:Car10 UTSW 11 93583021 critical splice donor site probably null
R0511:Car10 UTSW 11 93490582 missense probably damaging 1.00
R4692:Car10 UTSW 11 93185158 critical splice donor site probably null
R4799:Car10 UTSW 11 93578666 missense possibly damaging 0.81
R5947:Car10 UTSW 11 93490613 missense probably damaging 1.00
R6010:Car10 UTSW 11 93599323 missense possibly damaging 0.52
R6013:Car10 UTSW 11 93185279 intron probably benign
R7268:Car10 UTSW 11 93599251 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AATTTCACCAAGTAAAAGCGCATCCTTC -3'
(R):5'- CAGAGACTGTAGAATGATGCTCTGGTTG -3'

Sequencing Primer
(F):5'- gggtgagggaagggagg -3'
(R):5'- CTCTGGTTGGTATTGGGGG -3'
Posted On2014-02-18