Incidental Mutation 'R1372:Dsg4'
ID 157390
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Name desmoglein 4
Synonyms lah, CDHF13
MMRRC Submission 039436-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.589) question?
Stock # R1372 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 20436175-20471821 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 20449676 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
AlphaFold Q7TMD7
Predicted Effect probably null
Transcript: ENSMUST00000019426
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T A 8: 116,971,957 Q137L possibly damaging Het
Abca12 A G 1: 71,294,857 I1162T probably damaging Het
Adcy2 T A 13: 68,668,533 N778I probably damaging Het
Adgre5 G A 8: 83,728,320 P248S probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Ankrd28 A T 14: 31,745,261 M248K probably benign Het
Asxl3 T G 18: 22,410,009 S20A probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Car10 A T 11: 93,578,699 T167S probably benign Het
Cbx7 C T 15: 79,918,873 G160R probably damaging Het
Ccdc151 C T 9: 21,993,620 R290H probably damaging Het
Cd209d C A 8: 3,878,515 probably benign Het
Cdca4 G A 12: 112,821,917 Q64* probably null Het
Cela2a C T 4: 141,819,094 G178D probably damaging Het
Cntnap5b G A 1: 100,164,088 D499N probably benign Het
Cox7a2 G A 9: 79,758,537 R21* probably null Het
Crmp1 G A 5: 37,288,811 G604R probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Cxcr1 T C 1: 74,192,002 D287G probably benign Het
Cyp4a12b T C 4: 115,432,949 I233T probably benign Het
Dlg1 T C 16: 31,812,820 I208T probably damaging Het
Epha3 A G 16: 63,611,053 I495T possibly damaging Het
Gm4778 A G 3: 94,266,128 T148A possibly damaging Het
Hmcn1 A T 1: 150,680,715 M2440K probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Leo1 T C 9: 75,449,469 V377A possibly damaging Het
Lsg1 A G 16: 30,564,654 F583L possibly damaging Het
Mphosph9 A T 5: 124,283,745 probably null Het
Mpp3 A G 11: 102,000,575 V579A probably damaging Het
Oca2 T A 7: 56,535,968 M814K probably benign Het
Pdgfra A G 5: 75,189,263 E936G probably damaging Het
Pkd1 T C 17: 24,575,266 C1976R probably damaging Het
Plekhg5 G A 4: 152,104,731 R243H probably damaging Het
Pogz T A 3: 94,860,888 L126M probably damaging Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Rec8 T C 14: 55,618,974 Y68H probably damaging Het
Rhcg A T 7: 79,599,374 D366E probably benign Het
Ryr3 T A 2: 112,834,201 S1582C probably damaging Het
Sh3pxd2a A T 19: 47,267,721 W853R probably damaging Het
Tnxb T C 17: 34,710,293 V2770A possibly damaging Het
Vmn2r63 A G 7: 42,929,218 F84L possibly damaging Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20461326 missense probably benign 0.22
IGL01723:Dsg4 APN 18 20466510 missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20461304 missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20446250 splice site probably benign
IGL02553:Dsg4 APN 18 20462520 missense probably benign
IGL02578:Dsg4 APN 18 20471193 missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20458580 missense probably benign 0.01
IGL02677:Dsg4 APN 18 20464876 missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20471496 missense probably benign
IGL02747:Dsg4 APN 18 20446938 missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20451823 missense probably damaging 1.00
burrito UTSW 18 20451862 missense possibly damaging 0.81
woodshed UTSW 18 20451872 nonsense probably null
R0043:Dsg4 UTSW 18 20452972 missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20470879 missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20458571 missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20461359 missense probably benign 0.00
R0622:Dsg4 UTSW 18 20449788 missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20454646 splice site probably benign
R0786:Dsg4 UTSW 18 20449372 critical splice donor site probably null
R1114:Dsg4 UTSW 18 20466483 missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20446872 nonsense probably null
R1382:Dsg4 UTSW 18 20465124 missense probably benign 0.00
R1392:Dsg4 UTSW 18 20446247 splice site probably benign
R1442:Dsg4 UTSW 18 20462660 missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20449679 missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20471589 missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20462461 nonsense probably null
R1765:Dsg4 UTSW 18 20456831 missense probably benign 0.01
R1817:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20471212 missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20466636 nonsense probably null
R2097:Dsg4 UTSW 18 20471044 missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20461442 missense probably benign
R3551:Dsg4 UTSW 18 20451756 missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20471001 missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20449234 missense probably benign
R3955:Dsg4 UTSW 18 20449375 splice site probably null
R4006:Dsg4 UTSW 18 20470965 missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20451862 missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20458579 nonsense probably null
R4254:Dsg4 UTSW 18 20471538 missense probably benign 0.07
R4504:Dsg4 UTSW 18 20461436 missense probably benign 0.00
R4559:Dsg4 UTSW 18 20470921 missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20462413 missense probably benign 0.10
R4683:Dsg4 UTSW 18 20461409 missense probably benign
R4700:Dsg4 UTSW 18 20456908 missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20446831 missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20471127 missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20466621 missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20446839 missense probably benign 0.21
R5426:Dsg4 UTSW 18 20458484 missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20462492 nonsense probably null
R5982:Dsg4 UTSW 18 20465169 missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20466667 missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20449790 missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20471363 missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20458521 missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20451852 missense probably benign 0.01
R7196:Dsg4 UTSW 18 20466480 missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20446266 nonsense probably null
R7438:Dsg4 UTSW 18 20466628 missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20451936 splice site probably null
R7612:Dsg4 UTSW 18 20470990 missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20449712 missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
R8251:Dsg4 UTSW 18 20471164 missense probably damaging 1.00
R8326:Dsg4 UTSW 18 20449731 missense probably benign 0.31
R8554:Dsg4 UTSW 18 20453043 missense probably damaging 1.00
R8911:Dsg4 UTSW 18 20451872 nonsense probably null
R9059:Dsg4 UTSW 18 20471125 missense possibly damaging 0.62
R9508:Dsg4 UTSW 18 20471013 missense probably damaging 1.00
R9607:Dsg4 UTSW 18 20452990 missense probably benign 0.00
R9765:Dsg4 UTSW 18 20471277 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTGAAGGAGCTAAGTTGGTGTCCC -3'
(R):5'- TCGAGCCATAGATCGGAATGGAGTC -3'

Sequencing Primer
(F):5'- AAGTTGGTGTCCCATGTACTAC -3'
(R):5'- ATGATGCTGAACACTGGCTC -3'
Posted On 2014-02-18