Incidental Mutation 'R1373:Ccng2'
ID157398
Institutional Source Beutler Lab
Gene Symbol Ccng2
Ensembl Gene ENSMUSG00000029385
Gene Namecyclin G2
Synonyms
MMRRC Submission 039437-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1373 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location93267257-93276231 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 93271055 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031331] [ENSMUST00000121127]
Predicted Effect probably benign
Transcript: ENSMUST00000031331
SMART Domains Protein: ENSMUSP00000031331
Gene: ENSMUSG00000029385

DomainStartEndE-ValueType
CYCLIN 61 147 3.06e-15 SMART
low complexity region 218 237 N/A INTRINSIC
low complexity region 295 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121127
SMART Domains Protein: ENSMUSP00000113278
Gene: ENSMUSG00000029385

DomainStartEndE-ValueType
CYCLIN 61 147 3.06e-15 SMART
low complexity region 218 237 N/A INTRINSIC
low complexity region 295 317 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153260
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.2%
Validation Efficiency 94% (34/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The eukaryotic cell cycle is governed by cyclin-dependent protein kinases (CDKs) whose activities are regulated by cyclins and CDK inhibitors. The 8 species of cyclins reported in mammals, cyclins A through H, share a conserved amino acid sequence of about 90 residues called the cyclin box. The amino acid sequence of cyclin G is well conserved among mammals. The nucleotide sequence of cyclin G1 and cyclin G2 are 53% identical. Unlike cyclin G1, cyclin G2 contains a C-terminal PEST protein destabilization motif, suggesting that cyclin G2 expression is tightly regulated through the cell cycle. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 G A 14: 68,570,951 R317C probably damaging Het
Adgrl1 T C 8: 83,937,763 V1261A probably benign Het
Btla G A 16: 45,224,420 G23D probably benign Het
Card19 T C 13: 49,203,964 D110G probably damaging Het
Cbx7 C T 15: 79,918,873 G160R probably damaging Het
Col4a3 G A 1: 82,690,087 probably benign Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cps1 A G 1: 67,229,424 N1437S possibly damaging Het
Dcaf1 A G 9: 106,857,880 I676V probably benign Het
Dnah5 T A 15: 28,313,918 probably benign Het
Dock1 T C 7: 135,167,175 S1758P probably benign Het
Furin C T 7: 80,392,184 probably benign Het
Ice2 G A 9: 69,407,119 R50H probably benign Het
Ifi207 T A 1: 173,730,347 D275V unknown Het
Nrxn2 C T 19: 6,472,301 T190M probably damaging Het
Olfr699 C T 7: 106,790,756 V82I probably benign Het
Olfr761 T C 17: 37,952,360 I221M probably damaging Het
Pcnx3 A G 19: 5,665,516 L1494P probably damaging Het
Pitrm1 G T 13: 6,570,700 M739I probably benign Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Sfr1 C G 19: 47,734,916 D286E possibly damaging Het
Slx4 A G 16: 3,985,510 S1147P probably benign Het
Sry C G Y: 2,662,864 Q265H unknown Het
Tgfbr3 T C 5: 107,214,943 I68V probably benign Het
Tpmt A C 13: 47,027,258 probably null Het
Trpm5 A G 7: 143,086,842 probably benign Het
Ttc25 T C 11: 100,545,832 F11S probably damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp25 T C 16: 77,062,385 probably benign Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vps13c A T 9: 67,927,511 K1707N probably damaging Het
Other mutations in Ccng2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01148:Ccng2 APN 5 93270887 missense probably damaging 0.99
IGL01289:Ccng2 APN 5 93273417 missense probably null 0.88
R0133:Ccng2 UTSW 5 93273381 missense probably benign 0.15
R0266:Ccng2 UTSW 5 93271289 splice site probably benign
R0346:Ccng2 UTSW 5 93270894 missense probably damaging 1.00
R0401:Ccng2 UTSW 5 93273413 missense possibly damaging 0.52
R1087:Ccng2 UTSW 5 93273444 missense probably benign 0.17
R1696:Ccng2 UTSW 5 93273382 missense possibly damaging 0.90
R3727:Ccng2 UTSW 5 93274951 missense probably damaging 1.00
R5395:Ccng2 UTSW 5 93269398 missense possibly damaging 0.84
R6337:Ccng2 UTSW 5 93270921 missense probably benign
R6611:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7077:Ccng2 UTSW 5 93269340 missense possibly damaging 0.91
R7140:Ccng2 UTSW 5 93268755 missense probably benign 0.00
R7161:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7193:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7233:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7235:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7269:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7270:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7271:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7449:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7451:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7567:Ccng2 UTSW 5 93270872 missense probably benign 0.01
R7614:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7657:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7658:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7743:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7744:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7745:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7874:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7875:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7876:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7877:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7884:Ccng2 UTSW 5 93273343 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTGAAACCGAAACACCTGTCCTG -3'
(R):5'- TCGAGGCTGAGAATCTCCTTCCTG -3'

Sequencing Primer
(F):5'- GAAACACCTGTCCTGCATTGG -3'
(R):5'- TGAGAATCTCCTTCCTGTACAAAGC -3'
Posted On2014-02-18