Incidental Mutation 'R1373:Olfr699'
ID157403
Institutional Source Beutler Lab
Gene Symbol Olfr699
Ensembl Gene ENSMUSG00000096714
Gene Nameolfactory receptor 699
SynonymsMOR283-10P, GA_x6K02T2PBJ9-9168355-9167405
MMRRC Submission 039437-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R1373 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106787963-106793198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106790756 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 82 (V82I)
Ref Sequence ENSEMBL: ENSMUSP00000149112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065024] [ENSMUST00000215952] [ENSMUST00000216307]
Predicted Effect probably benign
Transcript: ENSMUST00000065024
AA Change: V82I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000068023
Gene: ENSMUSG00000096714
AA Change: V82I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 303 2.1e-5 PFAM
Pfam:7tm_1 41 290 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215952
AA Change: V82I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000216307
AA Change: V82I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.2%
Validation Efficiency 94% (34/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 G A 14: 68,570,951 R317C probably damaging Het
Adgrl1 T C 8: 83,937,763 V1261A probably benign Het
Btla G A 16: 45,224,420 G23D probably benign Het
Card19 T C 13: 49,203,964 D110G probably damaging Het
Cbx7 C T 15: 79,918,873 G160R probably damaging Het
Ccng2 C T 5: 93,271,055 probably benign Het
Col4a3 G A 1: 82,690,087 probably benign Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cps1 A G 1: 67,229,424 N1437S possibly damaging Het
Dcaf1 A G 9: 106,857,880 I676V probably benign Het
Dnah5 T A 15: 28,313,918 probably benign Het
Dock1 T C 7: 135,167,175 S1758P probably benign Het
Furin C T 7: 80,392,184 probably benign Het
Ice2 G A 9: 69,407,119 R50H probably benign Het
Ifi207 T A 1: 173,730,347 D275V unknown Het
Nrxn2 C T 19: 6,472,301 T190M probably damaging Het
Olfr761 T C 17: 37,952,360 I221M probably damaging Het
Pcnx3 A G 19: 5,665,516 L1494P probably damaging Het
Pitrm1 G T 13: 6,570,700 M739I probably benign Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Sfr1 C G 19: 47,734,916 D286E possibly damaging Het
Slx4 A G 16: 3,985,510 S1147P probably benign Het
Sry C G Y: 2,662,864 Q265H unknown Het
Tgfbr3 T C 5: 107,214,943 I68V probably benign Het
Tpmt A C 13: 47,027,258 probably null Het
Trpm5 A G 7: 143,086,842 probably benign Het
Ttc25 T C 11: 100,545,832 F11S probably damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp25 T C 16: 77,062,385 probably benign Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vps13c A T 9: 67,927,511 K1707N probably damaging Het
Other mutations in Olfr699
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Olfr699 APN 7 106790589 missense probably benign 0.12
IGL02093:Olfr699 APN 7 106790823 missense probably benign 0.12
IGL02404:Olfr699 APN 7 106790359 missense probably damaging 1.00
IGL03214:Olfr699 APN 7 106790345 missense probably benign
IGL03230:Olfr699 APN 7 106790704 missense probably damaging 1.00
R0194:Olfr699 UTSW 7 106790823 missense probably benign 0.12
R0523:Olfr699 UTSW 7 106790326 missense probably damaging 1.00
R1132:Olfr699 UTSW 7 106790551 missense possibly damaging 0.94
R1482:Olfr699 UTSW 7 106790333 missense probably benign 0.00
R1498:Olfr699 UTSW 7 106790416 missense possibly damaging 0.78
R1500:Olfr699 UTSW 7 106790821 missense probably damaging 1.00
R2656:Olfr699 UTSW 7 106790513 missense probably damaging 0.98
R4163:Olfr699 UTSW 7 106790279 missense probably damaging 1.00
R4638:Olfr699 UTSW 7 106790998 start codon destroyed probably null 1.00
R5104:Olfr699 UTSW 7 106790332 missense possibly damaging 0.81
R6216:Olfr699 UTSW 7 106790458 missense probably benign 0.23
R6976:Olfr699 UTSW 7 106790227 missense probably damaging 0.99
R7129:Olfr699 UTSW 7 106790483 missense probably benign 0.00
R7130:Olfr699 UTSW 7 106790182 missense probably benign 0.35
R8104:Olfr699 UTSW 7 106791130 start gained probably benign
R8104:Olfr699 UTSW 7 106791131 start gained probably benign
Z1177:Olfr699 UTSW 7 106790270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCAGCAATGGAGGGATTTCAC -3'
(R):5'- TGCTCTGTGCTGTAATCACAGCC -3'

Sequencing Primer
(F):5'- GTATATCCTAGAGCACTCAGAAGTC -3'
(R):5'- ACAGCCCTGTACATGTTAGCTATG -3'
Posted On2014-02-18