Incidental Mutation 'R1373:Sfr1'
ID157424
Institutional Source Beutler Lab
Gene Symbol Sfr1
Ensembl Gene ENSMUSG00000025066
Gene NameSWI5 dependent recombination repair 1
Synonyms
MMRRC Submission 039437-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1373 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47731756-47735588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 47734916 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 286 (D286E)
Ref Sequence ENSEMBL: ENSMUSP00000096954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099353] [ENSMUST00000160247]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099353
AA Change: D286E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096954
Gene: ENSMUSG00000025066
AA Change: D286E

DomainStartEndE-ValueType
low complexity region 16 61 N/A INTRINSIC
Pfam:Mei5 104 310 4.8e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160247
SMART Domains Protein: ENSMUSP00000125007
Gene: ENSMUSG00000044948

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
Blast:WD40 70 111 6e-7 BLAST
Blast:WD40 115 156 1e-5 BLAST
Blast:WD40 162 197 8e-10 BLAST
WD40 349 388 1.07e0 SMART
Blast:WD40 392 432 3e-13 BLAST
WD40 435 473 3.96e1 SMART
WD40 479 518 3.82e1 SMART
Blast:WD40 638 683 8e-17 BLAST
Blast:WD40 689 728 1e-17 BLAST
low complexity region 766 781 N/A INTRINSIC
coiled coil region 855 886 N/A INTRINSIC
coiled coil region 925 961 N/A INTRINSIC
low complexity region 971 981 N/A INTRINSIC
coiled coil region 1170 1224 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
low complexity region 1268 1279 N/A INTRINSIC
low complexity region 1524 1529 N/A INTRINSIC
coiled coil region 1652 1671 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161832
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162657
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.2%
Validation Efficiency 94% (34/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 G A 14: 68,570,951 R317C probably damaging Het
Adgrl1 T C 8: 83,937,763 V1261A probably benign Het
Btla G A 16: 45,224,420 G23D probably benign Het
Card19 T C 13: 49,203,964 D110G probably damaging Het
Cbx7 C T 15: 79,918,873 G160R probably damaging Het
Ccng2 C T 5: 93,271,055 probably benign Het
Col4a3 G A 1: 82,690,087 probably benign Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cps1 A G 1: 67,229,424 N1437S possibly damaging Het
Dcaf1 A G 9: 106,857,880 I676V probably benign Het
Dnah5 T A 15: 28,313,918 probably benign Het
Dock1 T C 7: 135,167,175 S1758P probably benign Het
Furin C T 7: 80,392,184 probably benign Het
Ice2 G A 9: 69,407,119 R50H probably benign Het
Ifi207 T A 1: 173,730,347 D275V unknown Het
Nrxn2 C T 19: 6,472,301 T190M probably damaging Het
Olfr699 C T 7: 106,790,756 V82I probably benign Het
Olfr761 T C 17: 37,952,360 I221M probably damaging Het
Pcnx3 A G 19: 5,665,516 L1494P probably damaging Het
Pitrm1 G T 13: 6,570,700 M739I probably benign Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Slx4 A G 16: 3,985,510 S1147P probably benign Het
Sry C G Y: 2,662,864 Q265H unknown Het
Tgfbr3 T C 5: 107,214,943 I68V probably benign Het
Tpmt A C 13: 47,027,258 probably null Het
Trpm5 A G 7: 143,086,842 probably benign Het
Ttc25 T C 11: 100,545,832 F11S probably damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp25 T C 16: 77,062,385 probably benign Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vps13c A T 9: 67,927,511 K1707N probably damaging Het
Other mutations in Sfr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02483:Sfr1 APN 19 47732788 unclassified probably benign
IGL02516:Sfr1 APN 19 47732990 critical splice donor site probably null
R0128:Sfr1 UTSW 19 47735018 makesense probably null
R1282:Sfr1 UTSW 19 47732968 missense probably damaging 1.00
R1396:Sfr1 UTSW 19 47733690 missense probably benign 0.37
R1709:Sfr1 UTSW 19 47735003 missense possibly damaging 0.76
R2306:Sfr1 UTSW 19 47734852 missense probably damaging 1.00
R5634:Sfr1 UTSW 19 47733871 missense probably damaging 1.00
R6714:Sfr1 UTSW 19 47734966 missense probably damaging 1.00
RF041:Sfr1 UTSW 19 47732868 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTTTGTCCAGAGCTTGTACTGCCC -3'
(R):5'- GGCCAAGTGTATAGCTCAGGAACAG -3'

Sequencing Primer
(F):5'- AGAGCTTGTACTGCCCTTTATAC -3'
(R):5'- TGTATAGCTCAGGAACAGAGCAC -3'
Posted On2014-02-18