Incidental Mutation 'R1374:Rims1'
ID157425
Institutional Source Beutler Lab
Gene Symbol Rims1
Ensembl Gene ENSMUSG00000041670
Gene Nameregulating synaptic membrane exocytosis 1
SynonymsRIM1a, RIM1, RIM1alpha, C030033M19Rik
MMRRC Submission 039438-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.690) question?
Stock #R1374 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location22286251-22805994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 22296948 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1176 (T1176M)
Ref Sequence ENSEMBL: ENSMUSP00000095419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081544] [ENSMUST00000097809] [ENSMUST00000097810] [ENSMUST00000097811] [ENSMUST00000115273] [ENSMUST00000164877]
Predicted Effect probably damaging
Transcript: ENSMUST00000081544
AA Change: T1040M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080259
Gene: ENSMUSG00000041670
AA Change: T1040M

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 2.6e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 899 934 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
C2 1120 1223 7.45e-15 SMART
low complexity region 1245 1253 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097809
AA Change: T1115M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095418
Gene: ENSMUSG00000041670
AA Change: T1115M

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 1e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 862 874 N/A INTRINSIC
low complexity region 974 1009 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
C2 1195 1298 7.45e-15 SMART
low complexity region 1320 1328 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097810
AA Change: T1176M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095419
Gene: ENSMUSG00000041670
AA Change: T1176M

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
PDB:2CJS|C 131 193 2e-32 PDB
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 862 874 N/A INTRINSIC
low complexity region 916 929 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
C2 1256 1359 7.45e-15 SMART
low complexity region 1381 1389 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097811
AA Change: T1204M

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095420
Gene: ENSMUSG00000041670
AA Change: T1204M

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 1.6e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 867 881 N/A INTRINSIC
low complexity region 944 957 N/A INTRINSIC
low complexity region 1063 1098 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
C2 1284 1387 7.45e-15 SMART
low complexity region 1409 1417 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115273
AA Change: T1091M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110928
Gene: ENSMUSG00000041670
AA Change: T1091M

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 2.8e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 950 985 N/A INTRINSIC
low complexity region 1062 1076 N/A INTRINSIC
C2 1171 1274 7.45e-15 SMART
low complexity region 1296 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164877
SMART Domains Protein: ENSMUSP00000131808
Gene: ENSMUSG00000041670

DomainStartEndE-ValueType
C2 79 182 7.45e-15 SMART
low complexity region 204 212 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000185942
AA Change: T508M
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 90.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RAS gene superfamily member that regulates synaptic vesicle exocytosis. This gene also plays a role in the regulation of voltage-gated calcium channels during neurotransmitter and insulin release. Mutations have suggested a role cognition and have been identified as the cause of cone-rod dystrophy type 7. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in maternal care and abnormalities in synaptic transmission in the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5z1 G A 5: 142,470,458 R344H probably damaging Het
C77080 A G 4: 129,222,289 S849P possibly damaging Het
Ccdc38 C T 10: 93,582,434 probably benign Het
Cd47 T C 16: 49,894,180 L184P probably damaging Het
Cps1 T C 1: 67,230,281 S1480P probably damaging Het
Cyp2a4 A G 7: 26,312,923 D377G probably damaging Het
Ddb1 G A 19: 10,608,318 G132D probably damaging Het
Dlgap2 T C 8: 14,831,228 probably benign Het
Epg5 A G 18: 77,981,326 D1132G probably benign Het
Fam184b T C 5: 45,555,143 E511G probably benign Het
Fbn1 T A 2: 125,346,434 D1495V probably damaging Het
Gpatch1 A T 7: 35,291,762 L619Q probably damaging Het
Inpp4b T G 8: 81,743,816 probably null Het
Kifc1 T C 17: 33,883,875 R192G probably benign Het
Klhl30 C T 1: 91,361,076 T519M probably damaging Het
Klhl8 A C 5: 103,863,183 L516R probably damaging Het
Meikin T A 11: 54,398,444 probably benign Het
Mlph T A 1: 90,941,703 S476T probably damaging Het
Neb T C 2: 52,243,389 Y3379C probably damaging Het
Nfxl1 G A 5: 72,524,145 T681I probably benign Het
Obox1 A T 7: 15,555,501 probably benign Het
Oplah G A 15: 76,306,555 R31C probably damaging Het
Polb T C 8: 22,653,057 probably benign Het
Ppfibp2 A G 7: 107,685,988 probably benign Het
Prr12 A G 7: 45,046,218 S1275P unknown Het
Ptcd3 C A 6: 71,908,653 E30* probably null Het
Ranbp2 T C 10: 58,485,893 probably benign Het
Rapgef2 A G 3: 79,087,968 V791A probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Ripor2 T C 13: 24,673,112 probably null Het
Sae1 A G 7: 16,378,408 I60T probably damaging Het
Tenm2 T C 11: 36,008,454 T2626A probably benign Het
Trrap A G 5: 144,846,618 Q3419R probably damaging Het
Vill C A 9: 119,061,494 N158K probably benign Het
Zbtb14 A G 17: 69,387,580 N91S probably damaging Het
Zfp248 A G 6: 118,433,373 L25P probably damaging Het
Zmym1 T A 4: 127,049,611 K230I probably damaging Het
Other mutations in Rims1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Rims1 APN 1 22468242 missense probably damaging 1.00
IGL00535:Rims1 APN 1 22432921 missense probably benign 0.02
IGL01021:Rims1 APN 1 22486620 missense probably damaging 1.00
IGL01106:Rims1 APN 1 22379447 missense probably damaging 1.00
IGL01128:Rims1 APN 1 22534175 missense probably damaging 0.97
IGL01548:Rims1 APN 1 22538602 missense probably damaging 1.00
IGL01688:Rims1 APN 1 22397540 missense probably benign 0.22
IGL02089:Rims1 APN 1 22630475 missense possibly damaging 0.68
IGL02245:Rims1 APN 1 22346488 missense probably damaging 0.98
IGL02355:Rims1 APN 1 22483207 missense probably damaging 1.00
IGL02362:Rims1 APN 1 22483207 missense probably damaging 1.00
IGL02682:Rims1 APN 1 22288484 missense probably damaging 1.00
IGL03006:Rims1 APN 1 22296954 missense probably damaging 0.99
IGL03054:Rims1 UTSW 1 22290109 missense probably damaging 1.00
PIT4504001:Rims1 UTSW 1 22397460 missense
R0031:Rims1 UTSW 1 22296879 missense probably damaging 1.00
R0118:Rims1 UTSW 1 22346407 missense probably damaging 1.00
R0390:Rims1 UTSW 1 22596526 missense possibly damaging 0.92
R0483:Rims1 UTSW 1 22468182 splice site probably benign
R0744:Rims1 UTSW 1 22427459 splice site probably null
R0836:Rims1 UTSW 1 22427459 splice site probably null
R1218:Rims1 UTSW 1 22483175 missense probably damaging 1.00
R1228:Rims1 UTSW 1 22472756 missense probably null 1.00
R1474:Rims1 UTSW 1 22538281 splice site probably benign
R1652:Rims1 UTSW 1 22292866 missense probably damaging 1.00
R1712:Rims1 UTSW 1 22296948 missense probably damaging 1.00
R1730:Rims1 UTSW 1 22346529 critical splice acceptor site probably null
R1783:Rims1 UTSW 1 22346529 critical splice acceptor site probably null
R1861:Rims1 UTSW 1 22596558 missense probably damaging 1.00
R1899:Rims1 UTSW 1 22428474 missense probably damaging 1.00
R1937:Rims1 UTSW 1 22288530 missense probably damaging 1.00
R2010:Rims1 UTSW 1 22296996 missense probably damaging 1.00
R2049:Rims1 UTSW 1 22596435 missense probably damaging 1.00
R2124:Rims1 UTSW 1 22404508 nonsense probably null
R2860:Rims1 UTSW 1 22432976 missense probably benign 0.01
R2861:Rims1 UTSW 1 22432976 missense probably benign 0.01
R2914:Rims1 UTSW 1 22805630 missense probably damaging 1.00
R3740:Rims1 UTSW 1 22373443 missense probably damaging 1.00
R3741:Rims1 UTSW 1 22373443 missense probably damaging 1.00
R3773:Rims1 UTSW 1 22421810 missense probably damaging 1.00
R3874:Rims1 UTSW 1 22428489 missense probably damaging 1.00
R3901:Rims1 UTSW 1 22533497 missense probably benign 0.00
R3964:Rims1 UTSW 1 22427459 splice site probably null
R4037:Rims1 UTSW 1 22475712 missense probably damaging 0.96
R4039:Rims1 UTSW 1 22475712 missense probably damaging 0.96
R4056:Rims1 UTSW 1 22292939 splice site probably benign
R4062:Rims1 UTSW 1 22533583 missense probably benign 0.00
R4552:Rims1 UTSW 1 22373494 missense probably damaging 0.99
R4658:Rims1 UTSW 1 22427543 missense probably damaging 0.98
R4688:Rims1 UTSW 1 22479447 nonsense probably null
R4696:Rims1 UTSW 1 22288612 missense probably damaging 1.00
R4720:Rims1 UTSW 1 22427481 missense probably damaging 1.00
R4764:Rims1 UTSW 1 22479462 missense probably damaging 1.00
R4780:Rims1 UTSW 1 22291105 missense probably damaging 1.00
R4931:Rims1 UTSW 1 22533947 missense probably benign 0.26
R5137:Rims1 UTSW 1 22288620 nonsense probably null
R5153:Rims1 UTSW 1 22483247 nonsense probably null
R5305:Rims1 UTSW 1 22596542 missense probably damaging 0.99
R5354:Rims1 UTSW 1 22538511 missense probably damaging 1.00
R5386:Rims1 UTSW 1 22412245 missense probably damaging 0.99
R5485:Rims1 UTSW 1 22483208 missense possibly damaging 0.93
R5643:Rims1 UTSW 1 22538509 missense probably damaging 1.00
R5929:Rims1 UTSW 1 22468241 missense probably damaging 1.00
R5988:Rims1 UTSW 1 22596463 missense probably damaging 1.00
R6160:Rims1 UTSW 1 22432984 missense probably damaging 0.98
R6579:Rims1 UTSW 1 22425916 missense probably damaging 1.00
R6790:Rims1 UTSW 1 22468197 missense probably damaging 1.00
R7048:Rims1 UTSW 1 22472820 missense probably damaging 1.00
R7100:Rims1 UTSW 1 22346473 missense probably benign 0.27
R7155:Rims1 UTSW 1 22432923 missense probably damaging 0.99
R7171:Rims1 UTSW 1 22428489 missense
R7448:Rims1 UTSW 1 22404475 missense
R7505:Rims1 UTSW 1 22533996 missense possibly damaging 0.55
R7567:Rims1 UTSW 1 22468210 missense probably damaging 0.99
R7639:Rims1 UTSW 1 22805669 missense probably benign 0.02
R7955:Rims1 UTSW 1 22468241 missense probably damaging 1.00
R8005:Rims1 UTSW 1 22412213 missense
R8071:Rims1 UTSW 1 22288536 nonsense probably null
R8465:Rims1 UTSW 1 22428480 missense possibly damaging 0.89
R8517:Rims1 UTSW 1 22483165 missense probably damaging 1.00
R8703:Rims1 UTSW 1 22425887 missense
R8726:Rims1 UTSW 1 22594100 missense possibly damaging 0.88
Z1088:Rims1 UTSW 1 22288586 missense probably damaging 1.00
Z1176:Rims1 UTSW 1 22484671 nonsense probably null
Z1177:Rims1 UTSW 1 22296939 missense possibly damaging 0.93
Z1177:Rims1 UTSW 1 22468241 missense probably damaging 1.00
Z1177:Rims1 UTSW 1 22472777 missense probably benign 0.44
Z1177:Rims1 UTSW 1 22472804 missense probably damaging 1.00
Z1186:Rims1 UTSW 1 22379482 missense
Predicted Primers PCR Primer
(F):5'- TGACAGATTGAACAGGTGCATGGAC -3'
(R):5'- CCAGACCCATTCTTTTCGGTGCAG -3'

Sequencing Primer
(F):5'- TTGAAACAGGTGCCGAAACTTC -3'
(R):5'- CTGGCTCAATAAAACTTGGCTCC -3'
Posted On2014-02-18