Incidental Mutation 'R1374:Sae1'
ID 157440
Institutional Source Beutler Lab
Gene Symbol Sae1
Ensembl Gene ENSMUSG00000052833
Gene Name SUMO1 activating enzyme subunit 1
Synonyms HSPC140, D7Ertd177e, Uble1a, 2610044L12Rik, AOS1, 2400010M20Rik, SUMO-1 activating enzyme subunit 1
MMRRC Submission 039438-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.963) question?
Stock # R1374 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 16320234-16387806 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 16378408 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 60 (I60T)
Ref Sequence ENSEMBL: ENSMUSP00000147771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094815] [ENSMUST00000210999] [ENSMUST00000211741]
AlphaFold Q9R1T2
Predicted Effect probably damaging
Transcript: ENSMUST00000094815
AA Change: I60T

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092409
Gene: ENSMUSG00000052833
AA Change: I60T

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:ThiF 23 344 4.3e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210999
AA Change: I60T

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000211741
AA Change: I60T

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.8275 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 90.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Posttranslational modification of proteins by the addition of the small protein SUMO (see SUMO1; MIM 601912), or sumoylation, regulates protein structure and intracellular localization. SAE1 and UBA2 (MIM 613295) form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins (Okuma et al., 1999 [PubMed 9920803]).[supplied by OMIM, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5z1 G A 5: 142,470,458 R344H probably damaging Het
C77080 A G 4: 129,222,289 S849P possibly damaging Het
Ccdc38 C T 10: 93,582,434 probably benign Het
Cd47 T C 16: 49,894,180 L184P probably damaging Het
Cps1 T C 1: 67,230,281 S1480P probably damaging Het
Cyp2a4 A G 7: 26,312,923 D377G probably damaging Het
Ddb1 G A 19: 10,608,318 G132D probably damaging Het
Dlgap2 T C 8: 14,831,228 probably benign Het
Epg5 A G 18: 77,981,326 D1132G probably benign Het
Fam184b T C 5: 45,555,143 E511G probably benign Het
Fbn1 T A 2: 125,346,434 D1495V probably damaging Het
Gpatch1 A T 7: 35,291,762 L619Q probably damaging Het
Inpp4b T G 8: 81,743,816 probably null Het
Kifc1 T C 17: 33,883,875 R192G probably benign Het
Klhl30 C T 1: 91,361,076 T519M probably damaging Het
Klhl8 A C 5: 103,863,183 L516R probably damaging Het
Meikin T A 11: 54,398,444 probably benign Het
Mlph T A 1: 90,941,703 S476T probably damaging Het
Neb T C 2: 52,243,389 Y3379C probably damaging Het
Nfxl1 G A 5: 72,524,145 T681I probably benign Het
Obox1 A T 7: 15,555,501 probably benign Het
Oplah G A 15: 76,306,555 R31C probably damaging Het
Polb T C 8: 22,653,057 probably benign Het
Ppfibp2 A G 7: 107,685,988 probably benign Het
Prr12 A G 7: 45,046,218 S1275P unknown Het
Ptcd3 C A 6: 71,908,653 E30* probably null Het
Ranbp2 T C 10: 58,485,893 probably benign Het
Rapgef2 A G 3: 79,087,968 V791A probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rims1 G A 1: 22,296,948 T1176M probably damaging Het
Ripor2 T C 13: 24,673,112 probably null Het
Tenm2 T C 11: 36,008,454 T2626A probably benign Het
Trrap A G 5: 144,846,618 Q3419R probably damaging Het
Vill C A 9: 119,061,494 N158K probably benign Het
Zbtb14 A G 17: 69,387,580 N91S probably damaging Het
Zfp248 A G 6: 118,433,373 L25P probably damaging Het
Zmym1 T A 4: 127,049,611 K230I probably damaging Het
Other mutations in Sae1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Sae1 APN 7 16330656 missense possibly damaging 0.94
IGL02672:Sae1 APN 7 16370348 missense probably damaging 1.00
IGL02881:Sae1 APN 7 16359118 missense probably damaging 1.00
R0255:Sae1 UTSW 7 16370322 nonsense probably null
R0667:Sae1 UTSW 7 16368532 missense probably damaging 1.00
R1585:Sae1 UTSW 7 16330612 critical splice donor site probably null
R1960:Sae1 UTSW 7 16368565 missense possibly damaging 0.90
R2278:Sae1 UTSW 7 16370366 missense probably damaging 1.00
R5513:Sae1 UTSW 7 16366856 missense probably benign 0.00
R5677:Sae1 UTSW 7 16370462 critical splice acceptor site probably null
R6694:Sae1 UTSW 7 16368536 missense probably damaging 1.00
R6975:Sae1 UTSW 7 16336787 missense probably damaging 0.99
R7307:Sae1 UTSW 7 16368544 nonsense probably null
R7914:Sae1 UTSW 7 16387723 missense unknown
R8437:Sae1 UTSW 7 16370354 missense probably damaging 1.00
R9076:Sae1 UTSW 7 16336743 missense probably benign
Z1177:Sae1 UTSW 7 16327871 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCCCATTCCCGAATCATTCCAGG -3'
(R):5'- AGGGCATACACAACGTGCTCAG -3'

Sequencing Primer
(F):5'- CAGGGGTTGAAGACTATATATTCACG -3'
(R):5'- CAACGTGCTCAGTAAAGAAGTC -3'
Posted On 2014-02-18