Incidental Mutation 'R1374:Cyp2a4'
ID157441
Institutional Source Beutler Lab
Gene Symbol Cyp2a4
Ensembl Gene ENSMUSG00000074254
Gene Namecytochrome P450, family 2, subfamily a, polypeptide 4
SynonymsD7Ucla4, Cyp15a1, testosterone 15alpha-hydroxylase
MMRRC Submission 039438-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R1374 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location26307169-26315088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26312923 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 377 (D377G)
Ref Sequence ENSEMBL: ENSMUSP00000096254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098657]
Predicted Effect probably damaging
Transcript: ENSMUST00000098657
AA Change: D377G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096254
Gene: ENSMUSG00000074254
AA Change: D377G

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 34 491 8.9e-151 PFAM
Meta Mutation Damage Score 0.8268 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 90.1%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5z1 G A 5: 142,470,458 R344H probably damaging Het
C77080 A G 4: 129,222,289 S849P possibly damaging Het
Ccdc38 C T 10: 93,582,434 probably benign Het
Cd47 T C 16: 49,894,180 L184P probably damaging Het
Cps1 T C 1: 67,230,281 S1480P probably damaging Het
Ddb1 G A 19: 10,608,318 G132D probably damaging Het
Dlgap2 T C 8: 14,831,228 probably benign Het
Epg5 A G 18: 77,981,326 D1132G probably benign Het
Fam184b T C 5: 45,555,143 E511G probably benign Het
Fbn1 T A 2: 125,346,434 D1495V probably damaging Het
Gpatch1 A T 7: 35,291,762 L619Q probably damaging Het
Inpp4b T G 8: 81,743,816 probably null Het
Kifc1 T C 17: 33,883,875 R192G probably benign Het
Klhl30 C T 1: 91,361,076 T519M probably damaging Het
Klhl8 A C 5: 103,863,183 L516R probably damaging Het
Meikin T A 11: 54,398,444 probably benign Het
Mlph T A 1: 90,941,703 S476T probably damaging Het
Neb T C 2: 52,243,389 Y3379C probably damaging Het
Nfxl1 G A 5: 72,524,145 T681I probably benign Het
Obox1 A T 7: 15,555,501 probably benign Het
Oplah G A 15: 76,306,555 R31C probably damaging Het
Polb T C 8: 22,653,057 probably benign Het
Ppfibp2 A G 7: 107,685,988 probably benign Het
Prr12 A G 7: 45,046,218 S1275P unknown Het
Ptcd3 C A 6: 71,908,653 E30* probably null Het
Ranbp2 T C 10: 58,485,893 probably benign Het
Rapgef2 A G 3: 79,087,968 V791A probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rims1 G A 1: 22,296,948 T1176M probably damaging Het
Ripor2 T C 13: 24,673,112 probably null Het
Sae1 A G 7: 16,378,408 I60T probably damaging Het
Tenm2 T C 11: 36,008,454 T2626A probably benign Het
Trrap A G 5: 144,846,618 Q3419R probably damaging Het
Vill C A 9: 119,061,494 N158K probably benign Het
Zbtb14 A G 17: 69,387,580 N91S probably damaging Het
Zfp248 A G 6: 118,433,373 L25P probably damaging Het
Zmym1 T A 4: 127,049,611 K230I probably damaging Het
Other mutations in Cyp2a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Cyp2a4 APN 7 26308544 missense probably damaging 1.00
IGL01609:Cyp2a4 APN 7 26308663 critical splice donor site probably null
IGL01959:Cyp2a4 APN 7 26307708 missense probably damaging 1.00
IGL02282:Cyp2a4 APN 7 26309047 missense probably benign 0.01
IGL03053:Cyp2a4 APN 7 26313550 splice site probably benign
IGL03168:Cyp2a4 APN 7 26313550 splice site probably benign
R0393:Cyp2a4 UTSW 7 26312868 missense possibly damaging 0.67
R0453:Cyp2a4 UTSW 7 26312833 missense probably benign 0.22
R0825:Cyp2a4 UTSW 7 26312916 missense probably benign 0.07
R0948:Cyp2a4 UTSW 7 26310788 missense probably damaging 1.00
R1215:Cyp2a4 UTSW 7 26314801 missense possibly damaging 0.75
R1222:Cyp2a4 UTSW 7 26308588 missense possibly damaging 0.70
R1473:Cyp2a4 UTSW 7 26314763 missense probably benign
R1580:Cyp2a4 UTSW 7 26307651 missense possibly damaging 0.91
R1768:Cyp2a4 UTSW 7 26312772 missense possibly damaging 0.94
R1832:Cyp2a4 UTSW 7 26312210 missense probably damaging 0.99
R1911:Cyp2a4 UTSW 7 26308974 missense possibly damaging 0.85
R2080:Cyp2a4 UTSW 7 26308537 missense possibly damaging 0.96
R2086:Cyp2a4 UTSW 7 26312308 missense probably damaging 1.00
R2259:Cyp2a4 UTSW 7 26309035 missense probably damaging 0.99
R2877:Cyp2a4 UTSW 7 26312187 missense possibly damaging 0.95
R2878:Cyp2a4 UTSW 7 26312187 missense possibly damaging 0.95
R3732:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3732:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3733:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3734:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3741:Cyp2a4 UTSW 7 26308544 missense probably damaging 1.00
R4079:Cyp2a4 UTSW 7 26307366 missense probably benign 0.22
R4297:Cyp2a4 UTSW 7 26307368 missense probably damaging 0.96
R4785:Cyp2a4 UTSW 7 26312875 missense probably damaging 1.00
R4998:Cyp2a4 UTSW 7 26307361 missense probably damaging 1.00
R5297:Cyp2a4 UTSW 7 26312204 missense probably benign 0.07
R5893:Cyp2a4 UTSW 7 26308928 missense probably damaging 1.00
R5942:Cyp2a4 UTSW 7 26310704 critical splice acceptor site probably null
R6262:Cyp2a4 UTSW 7 26312230 missense probably damaging 0.99
R6612:Cyp2a4 UTSW 7 26308647 missense probably benign 0.00
R6722:Cyp2a4 UTSW 7 26313558 missense probably benign 0.04
R7064:Cyp2a4 UTSW 7 26312307 missense probably benign 0.02
R7419:Cyp2a4 UTSW 7 26314763 missense probably benign 0.00
R7562:Cyp2a4 UTSW 7 26312896 missense possibly damaging 0.88
Z1176:Cyp2a4 UTSW 7 26307323 nonsense probably null
Z1176:Cyp2a4 UTSW 7 26310841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGCAATTCACACAGATCCCAAG -3'
(R):5'- TGGCAGAGAAAGCCTGTCACTGAG -3'

Sequencing Primer
(F):5'- AATGCCATACAATGTTCCCTGG -3'
(R):5'- TGTCACTGAGGCACCAAG -3'
Posted On2014-02-18