Incidental Mutation 'R1374:Cd47'
ID 157456
Institutional Source Beutler Lab
Gene Symbol Cd47
Ensembl Gene ENSMUSG00000055447
Gene Name CD47 antigen (Rh-related antigen, integrin-associated signal transducer)
Synonyms B430305P08Rik, 9130415E20Rik, integrin-associated protein, Itgp, IAP
MMRRC Submission 039438-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1374 (G1)
Quality Score 145
Status Validated
Chromosome 16
Chromosomal Location 49800533-49915010 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 49894180 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 184 (L184P)
Ref Sequence ENSEMBL: ENSMUSP00000155178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084838] [ENSMUST00000114496] [ENSMUST00000229101] [ENSMUST00000229104] [ENSMUST00000229206] [ENSMUST00000229640] [ENSMUST00000230281] [ENSMUST00000230641] [ENSMUST00000230836]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000084838
AA Change: L184P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099853
Gene: ENSMUSG00000055447
AA Change: L184P

DomainStartEndE-ValueType
Pfam:V-set_CD47 8 137 2.2e-46 PFAM
Pfam:CD47 163 317 4.7e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114496
AA Change: L131P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110140
Gene: ENSMUSG00000055447
AA Change: L131P

DomainStartEndE-ValueType
Pfam:V-set_CD47 1 41 1.8e-15 PFAM
Pfam:CD47 42 199 6.8e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229101
AA Change: L131P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000229104
AA Change: L110P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000229206
AA Change: L163P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000229640
AA Change: L131P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000230281
AA Change: L110P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000230641
AA Change: L184P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231187
Meta Mutation Damage Score 0.8850 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 90.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which is involved in the increase in intracellular calcium concentration that occurs upon cell adhesion to extracellular matrix. The encoded protein is also a receptor for the C-terminal cell binding domain of thrombospondin, and it may play a role in membrane transport and signal transduction. This gene has broad tissue distribution, and is reduced in expression on Rh erythrocytes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous mutation of this gene results in a reduced CD3+ fraction of peripheral lymphocytes and inability to clear infection by E.coli. Mutant animals are otherwise normal in appearance, survival, and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5z1 G A 5: 142,470,458 R344H probably damaging Het
C77080 A G 4: 129,222,289 S849P possibly damaging Het
Ccdc38 C T 10: 93,582,434 probably benign Het
Cps1 T C 1: 67,230,281 S1480P probably damaging Het
Cyp2a4 A G 7: 26,312,923 D377G probably damaging Het
Ddb1 G A 19: 10,608,318 G132D probably damaging Het
Dlgap2 T C 8: 14,831,228 probably benign Het
Epg5 A G 18: 77,981,326 D1132G probably benign Het
Fam184b T C 5: 45,555,143 E511G probably benign Het
Fbn1 T A 2: 125,346,434 D1495V probably damaging Het
Gpatch1 A T 7: 35,291,762 L619Q probably damaging Het
Inpp4b T G 8: 81,743,816 probably null Het
Kifc1 T C 17: 33,883,875 R192G probably benign Het
Klhl30 C T 1: 91,361,076 T519M probably damaging Het
Klhl8 A C 5: 103,863,183 L516R probably damaging Het
Meikin T A 11: 54,398,444 probably benign Het
Mlph T A 1: 90,941,703 S476T probably damaging Het
Neb T C 2: 52,243,389 Y3379C probably damaging Het
Nfxl1 G A 5: 72,524,145 T681I probably benign Het
Obox1 A T 7: 15,555,501 probably benign Het
Oplah G A 15: 76,306,555 R31C probably damaging Het
Polb T C 8: 22,653,057 probably benign Het
Ppfibp2 A G 7: 107,685,988 probably benign Het
Prr12 A G 7: 45,046,218 S1275P unknown Het
Ptcd3 C A 6: 71,908,653 E30* probably null Het
Ranbp2 T C 10: 58,485,893 probably benign Het
Rapgef2 A G 3: 79,087,968 V791A probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rims1 G A 1: 22,296,948 T1176M probably damaging Het
Ripor2 T C 13: 24,673,112 probably null Het
Sae1 A G 7: 16,378,408 I60T probably damaging Het
Tenm2 T C 11: 36,008,454 T2626A probably benign Het
Trrap A G 5: 144,846,618 Q3419R probably damaging Het
Vill C A 9: 119,061,494 N158K probably benign Het
Zbtb14 A G 17: 69,387,580 N91S probably damaging Het
Zfp248 A G 6: 118,433,373 L25P probably damaging Het
Zmym1 T A 4: 127,049,611 K230I probably damaging Het
Other mutations in Cd47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03253:Cd47 APN 16 49894198 missense probably benign 0.11
R0675:Cd47 UTSW 16 49906799 missense possibly damaging 0.61
R1651:Cd47 UTSW 16 49894228 missense possibly damaging 0.93
R1712:Cd47 UTSW 16 49894180 missense probably damaging 1.00
R1803:Cd47 UTSW 16 49867806 missense possibly damaging 0.87
R3720:Cd47 UTSW 16 49867842 missense probably benign 0.09
R3722:Cd47 UTSW 16 49867842 missense probably benign 0.09
R4525:Cd47 UTSW 16 49867792 missense probably benign 0.15
R5366:Cd47 UTSW 16 49896373 missense probably damaging 1.00
R6878:Cd47 UTSW 16 49910869 missense possibly damaging 0.82
R7219:Cd47 UTSW 16 49908077 missense possibly damaging 0.50
R7470:Cd47 UTSW 16 49884222 missense
R8068:Cd47 UTSW 16 49895416 missense
R8554:Cd47 UTSW 16 49867941 missense probably benign 0.00
R8772:Cd47 UTSW 16 49884212 missense
R9329:Cd47 UTSW 16 49896368 missense
R9447:Cd47 UTSW 16 49895459 missense
Predicted Primers PCR Primer
(F):5'- TGCAGGCAATAGAGTATCACCTACCC -3'
(R):5'- GCATCACTTGCCACAAGCTGTCAC -3'

Sequencing Primer
(F):5'- TAGAGTATCACCTACCCCTTCAC -3'
(R):5'- AGCTGTCACAGCAGCCC -3'
Posted On 2014-02-18