Incidental Mutation 'R1375:Stk17b'
ID 157461
Institutional Source Beutler Lab
Gene Symbol Stk17b
Ensembl Gene ENSMUSG00000026094
Gene Name serine/threonine kinase 17b (apoptosis-inducing)
Synonyms 3110009A03Rik, Drak2
MMRRC Submission 039439-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R1375 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 53755506-53785224 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53765947 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 152 (N152D)
Ref Sequence ENSEMBL: ENSMUSP00000027263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027263] [ENSMUST00000185920]
AlphaFold Q8BG48
Predicted Effect possibly damaging
Transcript: ENSMUST00000027263
AA Change: N152D

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027263
Gene: ENSMUSG00000026094
AA Change: N152D

S_TKc 33 293 5.77e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000185920
AA Change: N24D

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139880
Gene: ENSMUSG00000026094
AA Change: N24D

S_TKc 1 93 5.8e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187066
Meta Mutation Damage Score 0.0971 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.8%
  • 20x: 89.3%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Homozygous null mice display abnormal T cell numbers, increased T cell proliferation, abnormal cytokine physiology, and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,352,216 V1268A possibly damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cep85l A T 10: 53,349,258 D78E probably damaging Het
Csmd1 C A 8: 16,463,081 probably null Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Defb15 T C 8: 21,930,055 N19D possibly damaging Het
Dnah8 G A 17: 30,737,295 G2083D probably damaging Het
Fam208b A G 13: 3,576,029 V1307A probably benign Het
Ggn T C 7: 29,171,941 S249P probably damaging Het
Gm17541 A T 12: 4,689,825 probably benign Het
Gm765 C T 6: 98,238,299 C121Y possibly damaging Het
Gnptab T A 10: 88,432,573 L514Q probably damaging Het
Heg1 C A 16: 33,726,876 H678N possibly damaging Het
Heg1 T C 16: 33,727,309 I846T possibly damaging Het
Hydin G A 8: 110,506,222 probably null Het
Il17b T C 18: 61,690,254 V53A probably benign Het
Inpp5f T A 7: 128,664,029 L166* probably null Het
Myh9 A T 15: 77,769,368 probably null Het
Nsrp1 A G 11: 77,050,717 probably benign Het
Nup205 T C 6: 35,200,071 probably benign Het
Olfr1133 T A 2: 87,645,737 N129Y probably damaging Het
Olfr711 A G 7: 106,972,098 L82P probably damaging Het
Olfr801 A T 10: 129,670,372 L12Q probably null Het
Olfr910 T A 9: 38,539,534 V213D possibly damaging Het
Olr1 T C 6: 129,507,076 N11S possibly damaging Het
Pipox C A 11: 77,881,210 E363* probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rpp30 T C 19: 36,101,273 probably null Het
Sept1 T C 7: 127,218,161 D25G probably damaging Het
Thsd7b A T 1: 130,159,686 N1180I probably damaging Het
Other mutations in Stk17b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Stk17b APN 1 53764140 missense probably damaging 0.99
IGL00767:Stk17b APN 1 53764023 splice site probably benign
IGL01012:Stk17b APN 1 53761037 missense probably benign 0.06
IGL01431:Stk17b APN 1 53765915 splice site probably benign
IGL01914:Stk17b APN 1 53761067 missense probably damaging 0.98
IGL02236:Stk17b APN 1 53764088 missense probably damaging 1.00
IGL02827:Stk17b APN 1 53776542 missense probably benign 0.03
R0013:Stk17b UTSW 1 53764132 missense probably benign 0.36
R0545:Stk17b UTSW 1 53762583 splice site probably benign
R0831:Stk17b UTSW 1 53757492 missense probably damaging 1.00
R1035:Stk17b UTSW 1 53762599 missense probably benign 0.22
R1576:Stk17b UTSW 1 53757590 missense probably damaging 1.00
R1809:Stk17b UTSW 1 53765981 missense possibly damaging 0.80
R1988:Stk17b UTSW 1 53761082 missense probably damaging 1.00
R2033:Stk17b UTSW 1 53761076 missense probably damaging 1.00
R2105:Stk17b UTSW 1 53776605 missense probably benign 0.01
R2255:Stk17b UTSW 1 53776572 missense probably benign 0.00
R4395:Stk17b UTSW 1 53764115 missense probably damaging 0.98
R4521:Stk17b UTSW 1 53764038 missense probably damaging 1.00
R4777:Stk17b UTSW 1 53771708 missense probably damaging 1.00
R4871:Stk17b UTSW 1 53757534 missense probably benign 0.14
R4892:Stk17b UTSW 1 53771611 missense probably damaging 0.99
R4999:Stk17b UTSW 1 53761147 splice site probably null
R5122:Stk17b UTSW 1 53776558 missense probably damaging 1.00
R5621:Stk17b UTSW 1 53771784 nonsense probably null
R6636:Stk17b UTSW 1 53761088 missense probably damaging 1.00
R6924:Stk17b UTSW 1 53761059 missense possibly damaging 0.54
R7283:Stk17b UTSW 1 53757515 missense probably benign
R7322:Stk17b UTSW 1 53765945 missense probably benign 0.16
R7671:Stk17b UTSW 1 53766000 missense probably damaging 0.99
R8984:Stk17b UTSW 1 53757625 missense probably benign 0.05
R9476:Stk17b UTSW 1 53757739 missense probably damaging 1.00
R9510:Stk17b UTSW 1 53757739 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-02-18