Mutagenetix > Incidental Mutation

Incidental Mutation 'R1375:Septin1'

157469

Institutional Source

Beutler Lab

Gene Symbol

Septin1

Ensembl Gene

ENSMUSG00000000486

Gene Name

septin 1

Synonyms

Sept1, Diff6, PNUTL3

MMRRC Submission

039439-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R1375 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126813619-126832302 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 126817333 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 25 (D25G)

Ref Sequence

ENSEMBL: ENSMUSP00000146307 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032910] [ENSMUST00000106313] [ENSMUST00000106314] [ENSMUST00000127710] [ENSMUST00000152267] [ENSMUST00000133913] [ENSMUST00000206772] [ENSMUST00000206204] [ENSMUST00000142356]

AlphaFold

P42209

Predicted Effect

probably benign
Transcript: ENSMUST00000032910

SMART Domains

Protein: ENSMUSP00000032910
Gene: ENSMUSG00000030672

Domain	Start	End	E-Value	Type
EFh	29	57	9.77e-5	SMART
EFh	99	127	4.45e1	SMART
Blast:EFh	135	163	2e-11	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000106313

SMART Domains

Protein: ENSMUSP00000101920
Gene: ENSMUSG00000000486

Domain	Start	End	E-Value	Type
Pfam:DUF258	1	74	4.2e-8	PFAM
Pfam:MMR_HSR1	1	200	5.7e-8	PFAM
Pfam:Septin	1	274	5.7e-120	PFAM
coiled coil region	297	336	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106314
AA Change: D25G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101921
Gene: ENSMUSG00000000486
AA Change: D25G

Domain	Start	End	E-Value	Type
Pfam:Septin	22	302	3.9e-124	PFAM
Pfam:MMR_HSR1	27	171	6.2e-9	PFAM
low complexity region	349	363	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127710

SMART Domains

Protein: ENSMUSP00000120915
Gene: ENSMUSG00000030672

Domain	Start	End	E-Value	Type
Pfam:EF-hand_8	7	34	9.7e-3	PFAM
Pfam:EF-hand_1	9	37	1.6e-6	PFAM
Pfam:EF-hand_6	9	38	1.6e-6	PFAM
Pfam:EF-hand_8	21	54	5.1e-4	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131208

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133591

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133733

Predicted Effect

probably damaging
Transcript: ENSMUST00000152267
AA Change: D25G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000133913

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139613

Predicted Effect

probably benign
Transcript: ENSMUST00000206772

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143222

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138541

Predicted Effect

probably benign
Transcript: ENSMUST00000206204

Predicted Effect

probably benign
Transcript: ENSMUST00000142356

SMART Domains

Protein: ENSMUSP00000114468
Gene: ENSMUSG00000000486

Domain	Start	End	E-Value	Type
Pfam:DUF258	1	74	1.4e-8	PFAM
Pfam:MMR_HSR1	1	172	1.4e-8	PFAM
Pfam:Septin	1	186	3.1e-80	PFAM

Meta Mutation Damage Score

0.2878

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.8%
20x: 89.3%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	A	G	11: 94,243,042 (GRCm39)	V1268A	possibly damaging	Het
Ccng1	G	A	11: 40,642,941 (GRCm39)	P169S	probably benign	Het
Cep85l	A	T	10: 53,225,354 (GRCm39)	D78E	probably damaging	Het
Csmd1	C	A	8: 16,513,095 (GRCm39)		probably null	Het
Dapk2	C	G	9: 66,127,925 (GRCm39)	R68G	probably damaging	Het
Defb15	T	C	8: 22,420,071 (GRCm39)	N19D	possibly damaging	Het
Dnah8	G	A	17: 30,956,269 (GRCm39)	G2083D	probably damaging	Het
Ggn	T	C	7: 28,871,366 (GRCm39)	S249P	probably damaging	Het
Gm17541	A	T	12: 4,739,825 (GRCm39)		probably benign	Het
Gnptab	T	A	10: 88,268,435 (GRCm39)	L514Q	probably damaging	Het
Heg1	C	A	16: 33,547,246 (GRCm39)	H678N	possibly damaging	Het
Heg1	T	C	16: 33,547,679 (GRCm39)	I846T	possibly damaging	Het
Hydin	G	A	8: 111,232,854 (GRCm39)		probably null	Het
Il17b	T	C	18: 61,823,325 (GRCm39)	V53A	probably benign	Het
Inpp5f	T	A	7: 128,265,753 (GRCm39)	L166*	probably null	Het
Mdfic2	C	T	6: 98,215,260 (GRCm39)	C121Y	possibly damaging	Het
Myh9	A	T	15: 77,653,568 (GRCm39)		probably null	Het
Nsrp1	A	G	11: 76,941,543 (GRCm39)		probably benign	Het
Nup205	T	C	6: 35,177,006 (GRCm39)		probably benign	Het
Olr1	T	C	6: 129,484,039 (GRCm39)	N11S	possibly damaging	Het
Or5w1b	T	A	2: 87,476,081 (GRCm39)	N129Y	probably damaging	Het
Or6b6	A	G	7: 106,571,305 (GRCm39)	L82P	probably damaging	Het
Or6c211	A	T	10: 129,506,241 (GRCm39)	L12Q	probably null	Het
Or8b46	T	A	9: 38,450,830 (GRCm39)	V213D	possibly damaging	Het
Pipox	C	A	11: 77,772,036 (GRCm39)	E363*	probably null	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,558,948 (GRCm39)		probably benign	Het
Rpp30	T	C	19: 36,078,673 (GRCm39)		probably null	Het
Stk17b	T	C	1: 53,805,106 (GRCm39)	N152D	possibly damaging	Het
Tasor2	A	G	13: 3,626,029 (GRCm39)	V1307A	probably benign	Het
Thsd7b	A	T	1: 130,087,423 (GRCm39)	N1180I	probably damaging	Het

Other mutations in Septin1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0675:Septin1	UTSW	7	126,816,171 (GRCm39)	missense	probably damaging	0.99
R1627:Septin1	UTSW	7	126,817,230 (GRCm39)	critical splice acceptor site	probably null
R1886:Septin1	UTSW	7	126,813,937 (GRCm39)	unclassified	probably benign
R2409:Septin1	UTSW	7	126,815,143 (GRCm39)	critical splice acceptor site	probably null
R3872:Septin1	UTSW	7	126,814,447 (GRCm39)	unclassified	probably benign
R4320:Septin1	UTSW	7	126,816,200 (GRCm39)	missense	probably damaging	1.00
R4321:Septin1	UTSW	7	126,816,200 (GRCm39)	missense	probably damaging	1.00
R4323:Septin1	UTSW	7	126,816,200 (GRCm39)	missense	probably damaging	1.00
R4864:Septin1	UTSW	7	126,816,064 (GRCm39)	unclassified	probably benign
R5605:Septin1	UTSW	7	126,814,598 (GRCm39)	missense	probably damaging	1.00
R6838:Septin1	UTSW	7	126,815,894 (GRCm39)	missense	probably benign	0.01
R6870:Septin1	UTSW	7	126,816,876 (GRCm39)	missense	probably benign	0.25
R7030:Septin1	UTSW	7	126,816,157 (GRCm39)	missense	probably benign	0.12
R7494:Septin1	UTSW	7	126,814,122 (GRCm39)	missense	probably damaging	0.98
R7797:Septin1	UTSW	7	126,813,937 (GRCm39)	missense	unknown
R8002:Septin1	UTSW	7	126,815,074 (GRCm39)	missense	probably damaging	1.00
R9190:Septin1	UTSW	7	126,816,092 (GRCm39)	missense	probably benign	0.11
X0021:Septin1	UTSW	7	126,814,525 (GRCm39)	missense	possibly damaging	0.94
Z1177:Septin1	UTSW	7	126,816,074 (GRCm39)	missense	possibly damaging	0.84
Z1177:Septin1	UTSW	7	126,815,135 (GRCm39)	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- AGATTTACCACTGGCATCTGGCAC -3'
(R):5'- TCTAGTCATTCAGGGCCAGCTCTC -3'

Sequencing Primer
(F):5'- CCTGCCGATCCTCGTAGAG -3'
(R):5'- GAGGGTCCCCAGTTCAAAG -3'

Posted On

2014-02-18