Incidental Mutation 'R1375:Abcc3'
ID157483
Institutional Source Beutler Lab
Gene Symbol Abcc3
Ensembl Gene ENSMUSG00000020865
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 3
SynonymsMRP3, 1700019L09Rik
MMRRC Submission 039439-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1375 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location94343295-94392997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94352216 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1268 (V1268A)
Ref Sequence ENSEMBL: ENSMUSP00000021231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021231] [ENSMUST00000178136]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021231
AA Change: V1268A

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021231
Gene: ENSMUSG00000020865
AA Change: V1268A

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
transmembrane domain 172 190 N/A INTRINSIC
Pfam:ABC_membrane 310 581 4.4e-43 PFAM
AAA 652 827 2.77e-10 SMART
Pfam:ABC_membrane 963 1235 3.2e-46 PFAM
AAA 1310 1495 2.66e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140985
Predicted Effect probably benign
Transcript: ENSMUST00000178136
AA Change: V1269A

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136343
Gene: ENSMUSG00000020865
AA Change: V1269A

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
transmembrane domain 172 190 N/A INTRINSIC
Pfam:ABC_membrane 310 581 4.8e-34 PFAM
AAA 652 827 2.77e-10 SMART
coiled coil region 854 883 N/A INTRINSIC
Pfam:ABC_membrane 967 1236 8.6e-48 PFAM
AAA 1311 1496 2.66e-12 SMART
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.8%
  • 20x: 89.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein has not yet been determined; however, this protein may play a role in the transport of biliary and intestinal excretion of organic anions. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit increased liver bile acid levels after bile duct ligation [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cep85l A T 10: 53,349,258 D78E probably damaging Het
Csmd1 C A 8: 16,463,081 probably null Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Defb15 T C 8: 21,930,055 N19D possibly damaging Het
Dnah8 G A 17: 30,737,295 G2083D probably damaging Het
Fam208b A G 13: 3,576,029 V1307A probably benign Het
Ggn T C 7: 29,171,941 S249P probably damaging Het
Gm17541 A T 12: 4,689,825 probably benign Het
Gm765 C T 6: 98,238,299 C121Y possibly damaging Het
Gnptab T A 10: 88,432,573 L514Q probably damaging Het
Heg1 C A 16: 33,726,876 H678N possibly damaging Het
Heg1 T C 16: 33,727,309 I846T possibly damaging Het
Hydin G A 8: 110,506,222 probably null Het
Il17b T C 18: 61,690,254 V53A probably benign Het
Inpp5f T A 7: 128,664,029 L166* probably null Het
Myh9 A T 15: 77,769,368 probably null Het
Nsrp1 A G 11: 77,050,717 probably benign Het
Nup205 T C 6: 35,200,071 probably benign Het
Olfr1133 T A 2: 87,645,737 N129Y probably damaging Het
Olfr711 A G 7: 106,972,098 L82P probably damaging Het
Olfr801 A T 10: 129,670,372 L12Q probably null Het
Olfr910 T A 9: 38,539,534 V213D possibly damaging Het
Olr1 T C 6: 129,507,076 N11S possibly damaging Het
Pipox C A 11: 77,881,210 E363* probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rpp30 T C 19: 36,101,273 probably null Het
Sept1 T C 7: 127,218,161 D25G probably damaging Het
Stk17b T C 1: 53,765,947 N152D possibly damaging Het
Thsd7b A T 1: 130,159,686 N1180I probably damaging Het
Other mutations in Abcc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Abcc3 APN 11 94343785 splice site probably benign
IGL01154:Abcc3 APN 11 94359232 splice site probably benign
IGL01353:Abcc3 APN 11 94352108 missense possibly damaging 0.88
IGL02553:Abcc3 APN 11 94351924 missense probably damaging 1.00
IGL02795:Abcc3 APN 11 94361642 splice site probably benign
IGL02928:Abcc3 APN 11 94361306 missense possibly damaging 0.49
IGL02964:Abcc3 APN 11 94351810 missense possibly damaging 0.93
IGL03006:Abcc3 APN 11 94368595 missense probably benign 0.18
IGL03345:Abcc3 APN 11 94359337 missense probably damaging 1.00
R0200:Abcc3 UTSW 11 94355074 missense probably damaging 0.96
R0377:Abcc3 UTSW 11 94375096 missense possibly damaging 0.90
R0812:Abcc3 UTSW 11 94375202 splice site probably benign
R1269:Abcc3 UTSW 11 94357384 missense probably damaging 1.00
R1270:Abcc3 UTSW 11 94357384 missense probably damaging 1.00
R1506:Abcc3 UTSW 11 94357318 missense possibly damaging 0.89
R1525:Abcc3 UTSW 11 94361236 missense probably benign 0.00
R1842:Abcc3 UTSW 11 94359612 missense probably benign 0.00
R1868:Abcc3 UTSW 11 94364063 missense probably benign 0.06
R2069:Abcc3 UTSW 11 94364417 missense probably damaging 1.00
R2132:Abcc3 UTSW 11 94367600 missense probably benign 0.18
R2257:Abcc3 UTSW 11 94363594 missense probably damaging 1.00
R2395:Abcc3 UTSW 11 94357306 missense possibly damaging 0.90
R2930:Abcc3 UTSW 11 94361810 missense probably damaging 0.99
R3081:Abcc3 UTSW 11 94356976 missense probably damaging 1.00
R3824:Abcc3 UTSW 11 94368620 critical splice acceptor site probably null
R4385:Abcc3 UTSW 11 94368239 missense probably damaging 0.99
R4425:Abcc3 UTSW 11 94346044 missense probably damaging 0.98
R4464:Abcc3 UTSW 11 94358786 missense probably benign 0.01
R4696:Abcc3 UTSW 11 94350991 missense probably benign 0.01
R4877:Abcc3 UTSW 11 94367595 missense probably damaging 0.98
R5172:Abcc3 UTSW 11 94375608 missense probably damaging 1.00
R5586:Abcc3 UTSW 11 94364421 missense probably damaging 1.00
R5682:Abcc3 UTSW 11 94392897 missense probably benign 0.31
R5719:Abcc3 UTSW 11 94351068 missense probably damaging 1.00
R5816:Abcc3 UTSW 11 94343737 missense probably damaging 0.99
R5919:Abcc3 UTSW 11 94357306 missense possibly damaging 0.90
R6222:Abcc3 UTSW 11 94368605 missense probably benign 0.21
R6264:Abcc3 UTSW 11 94373998 missense probably damaging 0.99
R6526:Abcc3 UTSW 11 94359372 missense probably benign 0.21
R6782:Abcc3 UTSW 11 94358950 missense probably damaging 1.00
R6889:Abcc3 UTSW 11 94375555 missense possibly damaging 0.49
R6953:Abcc3 UTSW 11 94374835 missense probably benign 0.03
R7054:Abcc3 UTSW 11 94365225 missense probably benign 0.01
R7131:Abcc3 UTSW 11 94365031 missense probably damaging 1.00
R7210:Abcc3 UTSW 11 94373941 missense probably benign 0.03
R7283:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7284:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7285:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7287:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7320:Abcc3 UTSW 11 94367645 missense probably benign 0.33
R7450:Abcc3 UTSW 11 94361695 missense probably damaging 1.00
R7469:Abcc3 UTSW 11 94368188 missense probably damaging 1.00
X0064:Abcc3 UTSW 11 94363498 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACTTCCAGGTTTCCATCAGTAGC -3'
(R):5'- GGACTGCCTGATTTTGGAGAAGCAC -3'

Sequencing Primer
(F):5'- CGGTCCTCCCAACAAGG -3'
(R):5'- AGTGACAACATGCTTGCCTG -3'
Posted On2014-02-18