Incidental Mutation 'R1375:Fam208b'
ID 157485
Institutional Source Beutler Lab
Gene Symbol Fam208b
Ensembl Gene ENSMUSG00000033799
Gene Name family with sequence similarity 208, member B
Synonyms BC016423
MMRRC Submission 039439-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock # R1375 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 3566035-3611108 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3576029 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1307 (V1307A)
Ref Sequence ENSEMBL: ENSMUSP00000093774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096069]
AlphaFold Q5DTT3
Predicted Effect probably benign
Transcript: ENSMUST00000096069
AA Change: V1307A

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000093774
Gene: ENSMUSG00000033799
AA Change: V1307A

Pfam:DUF3699 91 167 1.4e-24 PFAM
low complexity region 272 282 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
Pfam:DUF3715 533 695 2.3e-25 PFAM
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 2012 2021 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221059
Predicted Effect unknown
Transcript: ENSMUST00000222909
AA Change: V625A
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.8%
  • 20x: 89.3%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,352,216 V1268A possibly damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cep85l A T 10: 53,349,258 D78E probably damaging Het
Csmd1 C A 8: 16,463,081 probably null Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Defb15 T C 8: 21,930,055 N19D possibly damaging Het
Dnah8 G A 17: 30,737,295 G2083D probably damaging Het
Ggn T C 7: 29,171,941 S249P probably damaging Het
Gm17541 A T 12: 4,689,825 probably benign Het
Gm765 C T 6: 98,238,299 C121Y possibly damaging Het
Gnptab T A 10: 88,432,573 L514Q probably damaging Het
Heg1 C A 16: 33,726,876 H678N possibly damaging Het
Heg1 T C 16: 33,727,309 I846T possibly damaging Het
Hydin G A 8: 110,506,222 probably null Het
Il17b T C 18: 61,690,254 V53A probably benign Het
Inpp5f T A 7: 128,664,029 L166* probably null Het
Myh9 A T 15: 77,769,368 probably null Het
Nsrp1 A G 11: 77,050,717 probably benign Het
Nup205 T C 6: 35,200,071 probably benign Het
Olfr1133 T A 2: 87,645,737 N129Y probably damaging Het
Olfr711 A G 7: 106,972,098 L82P probably damaging Het
Olfr801 A T 10: 129,670,372 L12Q probably null Het
Olfr910 T A 9: 38,539,534 V213D possibly damaging Het
Olr1 T C 6: 129,507,076 N11S possibly damaging Het
Pipox C A 11: 77,881,210 E363* probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rpp30 T C 19: 36,101,273 probably null Het
Sept1 T C 7: 127,218,161 D25G probably damaging Het
Stk17b T C 1: 53,765,947 N152D possibly damaging Het
Thsd7b A T 1: 130,159,686 N1180I probably damaging Het
Other mutations in Fam208b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Fam208b APN 13 3574832 missense probably benign
IGL00670:Fam208b APN 13 3585241 missense probably benign 0.14
IGL00957:Fam208b APN 13 3577101 missense possibly damaging 0.86
IGL01311:Fam208b APN 13 3575885 missense possibly damaging 0.85
IGL01318:Fam208b APN 13 3575067 missense possibly damaging 0.66
IGL01767:Fam208b APN 13 3576633 missense probably benign 0.00
IGL02073:Fam208b APN 13 3574721 missense probably benign 0.01
IGL02152:Fam208b APN 13 3585371 missense probably benign
IGL02431:Fam208b APN 13 3574736 missense possibly damaging 0.85
IGL02478:Fam208b APN 13 3574661 missense probably benign 0.12
IGL02732:Fam208b APN 13 3573626 missense probably benign 0.09
IGL02745:Fam208b APN 13 3585140 missense probably benign 0.23
IGL02800:Fam208b APN 13 3585154 missense probably benign
IGL02989:Fam208b APN 13 3584820 missense probably benign 0.01
IGL03124:Fam208b APN 13 3574704 missense probably benign 0.41
IGL03154:Fam208b APN 13 3575255 missense possibly damaging 0.56
IGL03216:Fam208b APN 13 3574553 missense probably damaging 0.98
BB001:Fam208b UTSW 13 3594331 missense possibly damaging 0.92
BB011:Fam208b UTSW 13 3594331 missense possibly damaging 0.92
H8562:Fam208b UTSW 13 3577000 missense probably damaging 0.98
PIT4585001:Fam208b UTSW 13 3574979 missense possibly damaging 0.55
R0016:Fam208b UTSW 13 3585170 splice site probably null
R0016:Fam208b UTSW 13 3585170 splice site probably null
R0157:Fam208b UTSW 13 3575550 missense probably benign 0.06
R0375:Fam208b UTSW 13 3596842 missense possibly damaging 0.85
R0403:Fam208b UTSW 13 3582052 nonsense probably null
R0472:Fam208b UTSW 13 3588364 missense possibly damaging 0.93
R0517:Fam208b UTSW 13 3566964 missense possibly damaging 0.94
R0586:Fam208b UTSW 13 3590321 missense probably damaging 0.99
R0600:Fam208b UTSW 13 3576054 missense probably benign
R0659:Fam208b UTSW 13 3574448 missense probably damaging 0.99
R1257:Fam208b UTSW 13 3575049 missense probably benign 0.25
R1443:Fam208b UTSW 13 3575543 missense probably benign 0.00
R1497:Fam208b UTSW 13 3570409 missense probably damaging 0.96
R1544:Fam208b UTSW 13 3590413 missense possibly damaging 0.68
R1554:Fam208b UTSW 13 3576374 missense possibly damaging 0.85
R1629:Fam208b UTSW 13 3574121 missense possibly damaging 0.84
R1633:Fam208b UTSW 13 3581771 missense possibly damaging 0.53
R1661:Fam208b UTSW 13 3573860 missense possibly damaging 0.63
R1673:Fam208b UTSW 13 3584498 critical splice donor site probably null
R1675:Fam208b UTSW 13 3569507 missense possibly damaging 0.65
R1781:Fam208b UTSW 13 3584759 missense possibly damaging 0.95
R1792:Fam208b UTSW 13 3590559 missense possibly damaging 0.91
R1826:Fam208b UTSW 13 3581759 missense probably damaging 0.98
R1920:Fam208b UTSW 13 3576612 missense possibly damaging 0.63
R1983:Fam208b UTSW 13 3574853 missense possibly damaging 0.92
R2016:Fam208b UTSW 13 3576770 missense probably benign 0.41
R2017:Fam208b UTSW 13 3576770 missense probably benign 0.41
R2220:Fam208b UTSW 13 3581872 missense probably benign 0.00
R2513:Fam208b UTSW 13 3582150 missense possibly damaging 0.53
R2898:Fam208b UTSW 13 3585122 missense possibly damaging 0.82
R2904:Fam208b UTSW 13 3582185 missense possibly damaging 0.53
R3149:Fam208b UTSW 13 3574359 missense probably damaging 0.98
R3623:Fam208b UTSW 13 3595556 missense probably benign
R3624:Fam208b UTSW 13 3595556 missense probably benign
R3725:Fam208b UTSW 13 3590538 missense probably benign 0.33
R3835:Fam208b UTSW 13 3575292 missense probably benign 0.01
R3890:Fam208b UTSW 13 3596785 missense probably damaging 0.96
R4023:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4024:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4025:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4050:Fam208b UTSW 13 3573507 missense probably benign 0.09
R4308:Fam208b UTSW 13 3569498 missense probably damaging 0.97
R4484:Fam208b UTSW 13 3581831 missense probably benign 0.12
R4674:Fam208b UTSW 13 3573686 missense possibly damaging 0.69
R4718:Fam208b UTSW 13 3574495 missense probably benign 0.00
R4745:Fam208b UTSW 13 3590069 missense probably benign 0.26
R4776:Fam208b UTSW 13 3570391 missense probably damaging 1.00
R4839:Fam208b UTSW 13 3584807 missense probably damaging 0.96
R4855:Fam208b UTSW 13 3566680 splice site probably null
R5049:Fam208b UTSW 13 3574000 missense probably benign 0.00
R5076:Fam208b UTSW 13 3576357 missense probably benign 0.41
R5287:Fam208b UTSW 13 3575744 missense probably benign 0.41
R5298:Fam208b UTSW 13 3595613 splice site probably null
R5379:Fam208b UTSW 13 3588496 missense probably benign 0.41
R5512:Fam208b UTSW 13 3595517 missense probably damaging 0.99
R5624:Fam208b UTSW 13 3584996 missense possibly damaging 0.66
R5750:Fam208b UTSW 13 3573642 nonsense probably null
R6114:Fam208b UTSW 13 3590081 missense probably damaging 1.00
R6118:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6119:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6269:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6270:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6271:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6272:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6525:Fam208b UTSW 13 3576540 nonsense probably null
R6550:Fam208b UTSW 13 3590519 missense possibly damaging 0.85
R6714:Fam208b UTSW 13 3594189 missense probably benign 0.00
R6797:Fam208b UTSW 13 3576769 missense probably benign 0.26
R6967:Fam208b UTSW 13 3574819 missense probably benign 0.22
R7016:Fam208b UTSW 13 3576857 missense possibly damaging 0.92
R7219:Fam208b UTSW 13 3590521 missense probably damaging 0.99
R7454:Fam208b UTSW 13 3585332 missense probably benign 0.21
R7570:Fam208b UTSW 13 3573621 missense probably damaging 0.99
R7571:Fam208b UTSW 13 3575292 missense probably benign 0.01
R7580:Fam208b UTSW 13 3574752 missense probably damaging 0.99
R7587:Fam208b UTSW 13 3568849 missense possibly damaging 0.83
R7657:Fam208b UTSW 13 3573777 missense probably damaging 0.98
R7810:Fam208b UTSW 13 3575714 missense possibly damaging 0.61
R7909:Fam208b UTSW 13 3573765 missense possibly damaging 0.93
R7924:Fam208b UTSW 13 3594331 missense possibly damaging 0.92
R7945:Fam208b UTSW 13 3576085 missense probably benign
R8005:Fam208b UTSW 13 3575681 missense probably benign
R8067:Fam208b UTSW 13 3569602 missense probably benign
R8112:Fam208b UTSW 13 3569516 missense probably damaging 1.00
R8162:Fam208b UTSW 13 3599691 missense probably damaging 0.96
R8170:Fam208b UTSW 13 3574881 nonsense probably null
R8240:Fam208b UTSW 13 3574388 missense probably benign
R8263:Fam208b UTSW 13 3575286 missense possibly damaging 0.70
R8263:Fam208b UTSW 13 3590016 missense probably benign 0.03
R8477:Fam208b UTSW 13 3575079 missense probably benign 0.18
R9022:Fam208b UTSW 13 3576659 missense probably benign
R9140:Fam208b UTSW 13 3588441 missense probably benign 0.04
R9167:Fam208b UTSW 13 3574724 missense probably benign
R9527:Fam208b UTSW 13 3585191 missense possibly damaging 0.61
R9535:Fam208b UTSW 13 3573559 missense possibly damaging 0.69
R9711:Fam208b UTSW 13 3599667 missense probably benign
X0024:Fam208b UTSW 13 3599837 missense probably null 0.99
X0025:Fam208b UTSW 13 3576827 missense probably benign 0.15
X0066:Fam208b UTSW 13 3588441 missense probably benign 0.04
Z1176:Fam208b UTSW 13 3576636 missense probably benign 0.01
Z1176:Fam208b UTSW 13 3588429 missense probably damaging 0.98
Z1177:Fam208b UTSW 13 3574234 missense probably damaging 0.96
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-02-18