Incidental Mutation 'R1314:Olfr1257'
ID 157494
Institutional Source Beutler Lab
Gene Symbol Olfr1257
Ensembl Gene ENSMUSG00000049057
Gene Name olfactory receptor 1257
Synonyms MOR232-1, GA_x6K02T2Q125-51319458-51320387
MMRRC Submission 039380-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R1314 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 89878437-89883026 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89880877 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 17 (E17G)
Ref Sequence ENSEMBL: ENSMUSP00000107144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060795] [ENSMUST00000111519]
AlphaFold Q8VGP0
Predicted Effect probably benign
Transcript: ENSMUST00000060795
AA Change: E17G

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000056439
Gene: ENSMUSG00000049057
AA Change: E17G

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 2.6e-31 PFAM
Pfam:7tm_4 137 278 8e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111519
AA Change: E17G

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107144
Gene: ENSMUSG00000049057
AA Change: E17G

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.5e-49 PFAM
Pfam:7tm_1 39 285 3.9e-18 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A G 12: 21,329,071 L659P probably damaging Het
Cachd1 G T 4: 100,974,917 G759C probably damaging Het
Depdc5 T A 5: 32,877,074 V95E probably damaging Het
Filip1 T A 9: 79,820,566 H257L probably damaging Het
Gfi1 A T 5: 107,721,874 probably null Het
Golim4 T C 3: 75,886,288 E579G probably damaging Het
Ikbkap T A 4: 56,786,647 H432L probably benign Het
Kcnip1 A G 11: 33,642,481 W140R probably damaging Het
Nutm1 A G 2: 112,249,809 I587T probably benign Het
Prkag3 A G 1: 74,747,184 S201P probably damaging Het
Prkdc C T 16: 15,664,227 A378V possibly damaging Het
Rarb A G 14: 16,508,932 probably null Het
Rfc2 T A 5: 134,591,200 N167K probably damaging Het
Rnf43 A G 11: 87,732,319 T749A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Tectb A G 19: 55,183,985 N155D probably damaging Het
Tnpo1 G A 13: 98,860,722 P400S probably damaging Het
Ugt8a T C 3: 125,871,748 T367A probably benign Het
Vmn2r39 A T 7: 9,014,982 M785K probably damaging Het
Zfp819 C T 7: 43,617,056 T321I probably benign Het
Other mutations in Olfr1257
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Olfr1257 APN 2 89881662 missense probably benign 0.02
IGL01641:Olfr1257 APN 2 89881608 missense probably benign 0.01
IGL01668:Olfr1257 APN 2 89881099 missense probably benign 0.01
IGL01901:Olfr1257 APN 2 89881482 missense probably damaging 1.00
IGL02401:Olfr1257 APN 2 89881453 missense probably damaging 1.00
IGL02472:Olfr1257 APN 2 89881411 missense probably benign 0.44
IGL02631:Olfr1257 APN 2 89881255 missense possibly damaging 0.95
PIT4354001:Olfr1257 UTSW 2 89881508 missense probably benign 0.04
R0552:Olfr1257 UTSW 2 89880891 nonsense probably null
R0616:Olfr1257 UTSW 2 89881591 missense probably benign 0.07
R0943:Olfr1257 UTSW 2 89880961 missense probably benign 0.11
R1146:Olfr1257 UTSW 2 89881206 missense probably damaging 1.00
R1146:Olfr1257 UTSW 2 89881206 missense probably damaging 1.00
R1641:Olfr1257 UTSW 2 89881401 missense probably benign 0.07
R1763:Olfr1257 UTSW 2 89881129 missense probably damaging 0.99
R1836:Olfr1257 UTSW 2 89881285 missense probably damaging 1.00
R2125:Olfr1257 UTSW 2 89881638 missense probably benign
R4322:Olfr1257 UTSW 2 89881734 missense probably benign 0.07
R4897:Olfr1257 UTSW 2 89881132 missense probably benign 0.39
R5446:Olfr1257 UTSW 2 89881549 missense probably damaging 1.00
R5456:Olfr1257 UTSW 2 89881258 missense probably damaging 0.97
R6415:Olfr1257 UTSW 2 89880862 missense probably damaging 1.00
R6905:Olfr1257 UTSW 2 89881708 missense probably benign 0.05
R7170:Olfr1257 UTSW 2 89880841 missense probably benign 0.12
R7170:Olfr1257 UTSW 2 89881053 missense possibly damaging 0.70
R7411:Olfr1257 UTSW 2 89881261 missense probably damaging 0.98
R8171:Olfr1257 UTSW 2 89881065 missense probably benign 0.05
R8490:Olfr1257 UTSW 2 89881167 missense probably damaging 1.00
R9176:Olfr1257 UTSW 2 89881171 missense probably benign 0.05
R9204:Olfr1257 UTSW 2 89881138 missense probably damaging 1.00
R9751:Olfr1257 UTSW 2 89881612 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTGTCCCGCACACTTATAAAAGTTCC -3'
(R):5'- CCCCAAAGATCTGAGTCATGCATCC -3'

Sequencing Primer
(F):5'- TGACTCTCTTAACAGAGTTGTCAC -3'
(R):5'- GCATCCATTAAATGGGATGGTC -3'
Posted On 2014-02-18