Incidental Mutation 'R1314:Ugt8a'
ID157497
Institutional Source Beutler Lab
Gene Symbol Ugt8a
Ensembl Gene ENSMUSG00000032854
Gene NameUDP galactosyltransferase 8A
SynonymsmCerGT, Cgt, Ugt8
MMRRC Submission 039380-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.646) question?
Stock #R1314 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location125865271-125938619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125871748 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 367 (T367A)
Ref Sequence ENSEMBL: ENSMUSP00000143605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057944] [ENSMUST00000198610]
Predicted Effect probably benign
Transcript: ENSMUST00000057944
AA Change: T367A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000050852
Gene: ENSMUSG00000032854
AA Change: T367A

DomainStartEndE-ValueType
Pfam:UDPGT 21 510 4.2e-121 PFAM
Pfam:Glyco_tran_28_C 326 437 6.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198610
AA Change: T367A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143605
Gene: ENSMUSG00000032854
AA Change: T367A

DomainStartEndE-ValueType
Pfam:UDPGT 21 510 4.2e-121 PFAM
Pfam:Glyco_tran_28_C 326 437 6.4e-9 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UDP-glycosyltransferase family. It catalyzes the transfer of galactose to ceramide, a key enzymatic step in the biosynthesis of galactocerebrosides, which are abundant sphingolipids of the myelin membrane of the central and peripheral nervous systems. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutants fail to make galactolipid galactocerebroside and its sulfated derivative that are normal myelin constituents. Mutants have tremors, ataxia, progressive hindlimb paralysis and vacuole formation in ventral spinal cord due to abnormal myelin sheath. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A G 12: 21,329,071 L659P probably damaging Het
Cachd1 G T 4: 100,974,917 G759C probably damaging Het
Depdc5 T A 5: 32,877,074 V95E probably damaging Het
Filip1 T A 9: 79,820,566 H257L probably damaging Het
Gfi1 A T 5: 107,721,874 probably null Het
Golim4 T C 3: 75,886,288 E579G probably damaging Het
Ikbkap T A 4: 56,786,647 H432L probably benign Het
Kcnip1 A G 11: 33,642,481 W140R probably damaging Het
Nutm1 A G 2: 112,249,809 I587T probably benign Het
Olfr1257 A G 2: 89,880,877 E17G probably benign Het
Prkag3 A G 1: 74,747,184 S201P probably damaging Het
Prkdc C T 16: 15,664,227 A378V possibly damaging Het
Rarb A G 14: 16,508,932 probably null Het
Rfc2 T A 5: 134,591,200 N167K probably damaging Het
Rnf43 A G 11: 87,732,319 T749A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Tectb A G 19: 55,183,985 N155D probably damaging Het
Tnpo1 G A 13: 98,860,722 P400S probably damaging Het
Vmn2r39 A T 7: 9,014,982 M785K probably damaging Het
Zfp819 C T 7: 43,617,056 T321I probably benign Het
Other mutations in Ugt8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ugt8a APN 3 125914636 critical splice donor site probably null
IGL01934:Ugt8a APN 3 125914775 missense probably benign 0.18
IGL02435:Ugt8a APN 3 125867320 missense probably benign 0.00
IGL03050:Ugt8a UTSW 3 125875490 missense possibly damaging 0.63
R0041:Ugt8a UTSW 3 125915090 missense probably benign 0.00
R0453:Ugt8a UTSW 3 125914957 missense probably benign 0.03
R1544:Ugt8a UTSW 3 125915449 missense probably benign 0.06
R1566:Ugt8a UTSW 3 125875558 missense probably damaging 0.96
R1770:Ugt8a UTSW 3 125874203 missense probably benign 0.11
R2126:Ugt8a UTSW 3 125875546 missense probably damaging 0.98
R2972:Ugt8a UTSW 3 125915308 missense probably benign
R2973:Ugt8a UTSW 3 125915308 missense probably benign
R3547:Ugt8a UTSW 3 125867382 nonsense probably null
R3906:Ugt8a UTSW 3 125914982 missense possibly damaging 0.95
R3907:Ugt8a UTSW 3 125914982 missense possibly damaging 0.95
R4032:Ugt8a UTSW 3 125874158 missense probably damaging 1.00
R5235:Ugt8a UTSW 3 125867480 missense probably damaging 1.00
R5890:Ugt8a UTSW 3 125875553 missense probably benign 0.01
R6790:Ugt8a UTSW 3 125871691 missense possibly damaging 0.93
R6937:Ugt8a UTSW 3 125915601 start gained probably benign
R7298:Ugt8a UTSW 3 125915416 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- ACTTTCACCAGGGCATCATACAGC -3'
(R):5'- AGCCCCATTGACTAGAAGGAATACCTC -3'

Sequencing Primer
(F):5'- GGGCATCATACAGCTCTCC -3'
(R):5'- AGCTAACCTTTCCATTCCTATGACAG -3'
Posted On2014-02-18