Mutagenetix > Incidental Mutation

Incidental Mutation 'R1314:Elp1'

157498

Institutional Source

Beutler Lab

Gene Symbol

Elp1

Ensembl Gene

ENSMUSG00000028431

Gene Name

elongator complex protein 1

Synonyms

Ikbkap, C78473, 3110040G09Rik, IKAP

MMRRC Submission

039380-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1314 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56749680-56802331 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 56786647 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 432 (H432L)

Ref Sequence

ENSEMBL: ENSMUSP00000030140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030140]

AlphaFold

Q7TT37

Predicted Effect

probably benign
Transcript: ENSMUST00000030140
AA Change: H432L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000030140
Gene: ENSMUSG00000028431
AA Change: H432L

Domain	Start	End	E-Value	Type
Pfam:IKI3	1	955	N/A	PFAM
low complexity region	1186	1205	N/A	INTRINSIC
low complexity region	1210	1225	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.1%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a scaffold protein and a regulator for three different kinases involved in proinflammatory signaling. The encoded protein can bind NF-kappa-B-inducing kinase and I-kappa-B kinases through separate domains and assemble them into an active kinase complex. Mutations in this gene have been associated with familial dysautonomia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with arrested neural and vascular development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam17	A	G	12: 21,379,072 (GRCm39)	L659P	probably damaging	Het
Cachd1	G	T	4: 100,832,114 (GRCm39)	G759C	probably damaging	Het
Depdc5	T	A	5: 33,034,418 (GRCm39)	V95E	probably damaging	Het
Filip1	T	A	9: 79,727,848 (GRCm39)	H257L	probably damaging	Het
Gfi1	A	T	5: 107,869,740 (GRCm39)		probably null	Het
Golim4	T	C	3: 75,793,595 (GRCm39)	E579G	probably damaging	Het
Kcnip1	A	G	11: 33,592,481 (GRCm39)	W140R	probably damaging	Het
Nutm1	A	G	2: 112,080,154 (GRCm39)	I587T	probably benign	Het
Or4c10b	A	G	2: 89,711,221 (GRCm39)	E17G	probably benign	Het
Prkag3	A	G	1: 74,786,343 (GRCm39)	S201P	probably damaging	Het
Prkdc	C	T	16: 15,482,091 (GRCm39)	A378V	possibly damaging	Het
Rarb	A	G	14: 16,508,932 (GRCm38)		probably null	Het
Rfc2	T	A	5: 134,620,054 (GRCm39)	N167K	probably damaging	Het
Rnf43	A	G	11: 87,623,145 (GRCm39)	T749A	probably benign	Het
Slc35e1	T	C	8: 73,246,415 (GRCm39)		probably benign	Het
Tectb	A	G	19: 55,172,417 (GRCm39)	N155D	probably damaging	Het
Tnpo1	G	A	13: 98,997,230 (GRCm39)	P400S	probably damaging	Het
Ugt8a	T	C	3: 125,665,397 (GRCm39)	T367A	probably benign	Het
Vmn2r39	A	T	7: 9,017,981 (GRCm39)	M785K	probably damaging	Het
Zfp819	C	T	7: 43,266,480 (GRCm39)	T321I	probably benign	Het

Other mutations in Elp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01060:Elp1	APN	4	56,784,537 (GRCm39)	critical splice donor site	probably null
IGL01521:Elp1	APN	4	56,771,059 (GRCm39)	missense	probably benign	0.27
IGL02069:Elp1	APN	4	56,779,731 (GRCm39)	missense	probably benign	0.31
IGL02162:Elp1	APN	4	56,796,502 (GRCm39)	critical splice donor site	probably null
IGL02252:Elp1	APN	4	56,759,813 (GRCm39)	missense	probably benign	0.09
IGL02726:Elp1	APN	4	56,767,878 (GRCm39)	critical splice acceptor site	probably null
IGL02822:Elp1	APN	4	56,774,520 (GRCm39)	critical splice donor site	probably null
IGL03024:Elp1	APN	4	56,774,686 (GRCm39)	critical splice donor site	probably null
IGL03126:Elp1	APN	4	56,779,717 (GRCm39)	missense	probably benign
R0211:Elp1	UTSW	4	56,795,545 (GRCm39)	missense	probably damaging	1.00
R0239:Elp1	UTSW	4	56,784,596 (GRCm39)	missense	probably benign	0.00
R0239:Elp1	UTSW	4	56,784,596 (GRCm39)	missense	probably benign	0.00
R0603:Elp1	UTSW	4	56,792,105 (GRCm39)	missense	possibly damaging	0.94
R1109:Elp1	UTSW	4	56,786,723 (GRCm39)	missense	probably benign	0.00
R1333:Elp1	UTSW	4	56,770,969 (GRCm39)	splice site	probably benign
R1434:Elp1	UTSW	4	56,781,193 (GRCm39)	missense	probably benign	0.02
R1547:Elp1	UTSW	4	56,798,810 (GRCm39)	missense	probably damaging	1.00
R1547:Elp1	UTSW	4	56,792,090 (GRCm39)	missense	probably damaging	1.00
R1587:Elp1	UTSW	4	56,786,666 (GRCm39)	nonsense	probably null
R1601:Elp1	UTSW	4	56,774,756 (GRCm39)	nonsense	probably null
R2076:Elp1	UTSW	4	56,786,620 (GRCm39)	missense	probably damaging	0.98
R2153:Elp1	UTSW	4	56,779,636 (GRCm39)	splice site	probably null
R2263:Elp1	UTSW	4	56,755,298 (GRCm39)	splice site	probably null
R2325:Elp1	UTSW	4	56,784,622 (GRCm39)	missense	probably benign	0.00
R2333:Elp1	UTSW	4	56,775,456 (GRCm39)	missense	probably benign	0.28
R3151:Elp1	UTSW	4	56,770,985 (GRCm39)	missense	probably benign	0.24
R3622:Elp1	UTSW	4	56,759,925 (GRCm39)	splice site	probably null
R3624:Elp1	UTSW	4	56,798,708 (GRCm39)	missense	possibly damaging	0.52
R3889:Elp1	UTSW	4	56,759,852 (GRCm39)	missense	probably damaging	1.00
R4007:Elp1	UTSW	4	56,794,139 (GRCm39)	missense	probably damaging	1.00
R4196:Elp1	UTSW	4	56,755,353 (GRCm39)	missense	probably damaging	1.00
R4794:Elp1	UTSW	4	56,781,176 (GRCm39)	small deletion	probably benign
R5330:Elp1	UTSW	4	56,800,001 (GRCm39)	missense	probably benign	0.01
R5331:Elp1	UTSW	4	56,800,001 (GRCm39)	missense	probably benign	0.01
R5360:Elp1	UTSW	4	56,800,104 (GRCm39)	missense	probably benign	0.06
R5362:Elp1	UTSW	4	56,778,969 (GRCm39)	missense	probably damaging	0.99
R5645:Elp1	UTSW	4	56,776,920 (GRCm39)	missense	possibly damaging	0.93
R5877:Elp1	UTSW	4	56,787,807 (GRCm39)	missense	probably damaging	1.00
R6268:Elp1	UTSW	4	56,762,305 (GRCm39)	missense	probably damaging	1.00
R6284:Elp1	UTSW	4	56,762,281 (GRCm39)	missense	probably damaging	0.99
R6526:Elp1	UTSW	4	56,798,812 (GRCm39)	critical splice acceptor site	probably null
R6610:Elp1	UTSW	4	56,758,236 (GRCm39)	missense	probably benign	0.02
R6627:Elp1	UTSW	4	56,784,647 (GRCm39)	splice site	probably null
R6786:Elp1	UTSW	4	56,771,555 (GRCm39)	missense	possibly damaging	0.80
R6823:Elp1	UTSW	4	56,787,939 (GRCm39)	missense	probably damaging	1.00
R7129:Elp1	UTSW	4	56,787,944 (GRCm39)	missense	probably damaging	1.00
R7157:Elp1	UTSW	4	56,781,176 (GRCm39)	small deletion	probably benign
R7180:Elp1	UTSW	4	56,796,535 (GRCm39)	missense	probably damaging	1.00
R7391:Elp1	UTSW	4	56,781,212 (GRCm39)	missense	probably benign	0.00
R7391:Elp1	UTSW	4	56,781,211 (GRCm39)	missense	possibly damaging	0.82
R7403:Elp1	UTSW	4	56,778,994 (GRCm39)	missense	probably damaging	1.00
R7432:Elp1	UTSW	4	56,776,925 (GRCm39)	missense	probably damaging	1.00
R7674:Elp1	UTSW	4	56,792,075 (GRCm39)	missense	probably damaging	0.97
R7736:Elp1	UTSW	4	56,776,920 (GRCm39)	missense	possibly damaging	0.93
R7755:Elp1	UTSW	4	56,774,552 (GRCm39)	missense	possibly damaging	0.80
R7760:Elp1	UTSW	4	56,790,892 (GRCm39)	missense	probably benign	0.20
R7849:Elp1	UTSW	4	56,758,968 (GRCm39)	missense	possibly damaging	0.65
R7959:Elp1	UTSW	4	56,774,737 (GRCm39)	missense	probably damaging	1.00
R7970:Elp1	UTSW	4	56,771,466 (GRCm39)	missense	probably damaging	1.00
R8324:Elp1	UTSW	4	56,772,491 (GRCm39)	missense	probably damaging	1.00
R8456:Elp1	UTSW	4	56,781,176 (GRCm39)	small deletion	probably benign
R8671:Elp1	UTSW	4	56,771,453 (GRCm39)	missense	probably damaging	1.00
R9245:Elp1	UTSW	4	56,771,003 (GRCm39)	missense	probably benign	0.01
R9562:Elp1	UTSW	4	56,772,521 (GRCm39)	missense	probably benign	0.00
R9565:Elp1	UTSW	4	56,772,521 (GRCm39)	missense	probably benign	0.00
R9568:Elp1	UTSW	4	56,786,711 (GRCm39)	missense	probably damaging	1.00
Z1176:Elp1	UTSW	4	56,790,146 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GAAACTCTGGCTCTGAGATGCCAC -3'
(R):5'- TTAGCTACGCGCACACAGAGATCC -3'

Sequencing Primer
(F):5'- TGCCACCACACTGTGACTG -3'
(R):5'- AGAGATCCTCATGCCTGTACTG -3'

Posted On

2014-02-18