Incidental Mutation 'R1314:Vmn2r39'
ID157503
Institutional Source Beutler Lab
Gene Symbol Vmn2r39
Ensembl Gene ENSMUSG00000096658
Gene Namevomeronasal 2, receptor 39
SynonymsEG545909
MMRRC Submission 039380-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R1314 (G1)
Quality Score165
Status Not validated
Chromosome7
Chromosomal Location9013875-9030798 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9014982 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 785 (M785K)
Ref Sequence ENSEMBL: ENSMUSP00000134010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174388]
Predicted Effect probably damaging
Transcript: ENSMUST00000174388
AA Change: M785K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134010
Gene: ENSMUSG00000096658
AA Change: M785K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 9.1e-32 PFAM
Pfam:NCD3G 512 565 7.9e-21 PFAM
Pfam:7tm_3 598 833 2.6e-55 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A G 12: 21,329,071 L659P probably damaging Het
Cachd1 G T 4: 100,974,917 G759C probably damaging Het
Depdc5 T A 5: 32,877,074 V95E probably damaging Het
Filip1 T A 9: 79,820,566 H257L probably damaging Het
Gfi1 A T 5: 107,721,874 probably null Het
Golim4 T C 3: 75,886,288 E579G probably damaging Het
Ikbkap T A 4: 56,786,647 H432L probably benign Het
Kcnip1 A G 11: 33,642,481 W140R probably damaging Het
Nutm1 A G 2: 112,249,809 I587T probably benign Het
Olfr1257 A G 2: 89,880,877 E17G probably benign Het
Prkag3 A G 1: 74,747,184 S201P probably damaging Het
Prkdc C T 16: 15,664,227 A378V possibly damaging Het
Rarb A G 14: 16,508,932 probably null Het
Rfc2 T A 5: 134,591,200 N167K probably damaging Het
Rnf43 A G 11: 87,732,319 T749A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Tectb A G 19: 55,183,985 N155D probably damaging Het
Tnpo1 G A 13: 98,860,722 P400S probably damaging Het
Ugt8a T C 3: 125,871,748 T367A probably benign Het
Zfp819 C T 7: 43,617,056 T321I probably benign Het
Other mutations in Vmn2r39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02059:Vmn2r39 APN 7 9023644 missense probably benign 0.19
IGL03017:Vmn2r39 APN 7 9014941 missense probably damaging 1.00
R1358:Vmn2r39 UTSW 7 9023688 missense possibly damaging 0.63
R1480:Vmn2r39 UTSW 7 9014956 missense probably damaging 1.00
R4119:Vmn2r39 UTSW 7 9023674 missense probably benign 0.01
R4120:Vmn2r39 UTSW 7 9023674 missense probably benign 0.01
R4720:Vmn2r39 UTSW 7 9023470 critical splice donor site probably null
R4990:Vmn2r39 UTSW 7 9023676 missense probably benign
R5079:Vmn2r39 UTSW 7 9023490 missense probably benign 0.05
R5695:Vmn2r39 UTSW 7 9025151 missense possibly damaging 0.87
R6131:Vmn2r39 UTSW 7 9014964 missense probably damaging 1.00
R6561:Vmn2r39 UTSW 7 9015093 missense probably damaging 1.00
R7108:Vmn2r39 UTSW 7 9023668 missense probably damaging 0.96
R7122:Vmn2r39 UTSW 7 9014762 missense possibly damaging 0.72
Z1176:Vmn2r39 UTSW 7 9015033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACATCACTAGAGCAACCAGTGAGAG -3'
(R):5'- TCCTTGTATCAGGGACACCCAACTAC -3'

Sequencing Primer
(F):5'- TGAGAGTGATTCTAAAACTGGACAC -3'
(R):5'- GATATTGATGAACACTCTCAGCATGG -3'
Posted On2014-02-18