Incidental Mutation 'R1314:Rarb'
ID 157512
Institutional Source Beutler Lab
Gene Symbol Rarb
Ensembl Gene ENSMUSG00000017491
Gene Name retinoic acid receptor, beta
Synonyms RARbeta2, RAR beta 2, Hap
MMRRC Submission 039380-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1314 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 5650540-6038924 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 16508932 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063750] [ENSMUST00000223576] [ENSMUST00000223976] [ENSMUST00000225594] [ENSMUST00000225921]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000063750
SMART Domains Protein: ENSMUSP00000067694
Gene: ENSMUSG00000017491

DomainStartEndE-ValueType
low complexity region 52 75 N/A INTRINSIC
ZnF_C4 78 149 3.77e-40 SMART
HOLI 223 381 1.72e-34 SMART
low complexity region 428 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223576
Predicted Effect probably benign
Transcript: ENSMUST00000223976
Predicted Effect probably benign
Transcript: ENSMUST00000225594
Predicted Effect probably null
Transcript: ENSMUST00000225921
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes retinoic acid receptor beta, a member of the thyroid-steroid hormone receptor superfamily of nuclear transcriptional regulators. This receptor localizes to the cytoplasm and to subnuclear compartments. It binds retinoic acid, the biologically active form of vitamin A which mediates cellular signalling in embryonic morphogenesis, cell growth and differentiation. It is thought that this protein limits growth of many cell types by regulating gene expression. The gene was first identified in a hepatocellular carcinoma where it flanks a hepatitis B virus integration site. Alternate promoter usage and differential splicing result in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, but are otherwise normal. Rarb/Rara double knockouts exhibit impaired vitamin A signaling and develop urogenital malformations, including renal hypoplasia and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A G 12: 21,379,072 (GRCm39) L659P probably damaging Het
Cachd1 G T 4: 100,832,114 (GRCm39) G759C probably damaging Het
Depdc5 T A 5: 33,034,418 (GRCm39) V95E probably damaging Het
Elp1 T A 4: 56,786,647 (GRCm39) H432L probably benign Het
Filip1 T A 9: 79,727,848 (GRCm39) H257L probably damaging Het
Gfi1 A T 5: 107,869,740 (GRCm39) probably null Het
Golim4 T C 3: 75,793,595 (GRCm39) E579G probably damaging Het
Kcnip1 A G 11: 33,592,481 (GRCm39) W140R probably damaging Het
Nutm1 A G 2: 112,080,154 (GRCm39) I587T probably benign Het
Or4c10b A G 2: 89,711,221 (GRCm39) E17G probably benign Het
Prkag3 A G 1: 74,786,343 (GRCm39) S201P probably damaging Het
Prkdc C T 16: 15,482,091 (GRCm39) A378V possibly damaging Het
Rfc2 T A 5: 134,620,054 (GRCm39) N167K probably damaging Het
Rnf43 A G 11: 87,623,145 (GRCm39) T749A probably benign Het
Slc35e1 T C 8: 73,246,415 (GRCm39) probably benign Het
Tectb A G 19: 55,172,417 (GRCm39) N155D probably damaging Het
Tnpo1 G A 13: 98,997,230 (GRCm39) P400S probably damaging Het
Ugt8a T C 3: 125,665,397 (GRCm39) T367A probably benign Het
Vmn2r39 A T 7: 9,017,981 (GRCm39) M785K probably damaging Het
Zfp819 C T 7: 43,266,480 (GRCm39) T321I probably benign Het
Other mutations in Rarb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Rarb APN 14 16,443,791 (GRCm38) nonsense probably null
IGL01483:Rarb APN 14 16,432,273 (GRCm38) splice site probably benign
IGL01591:Rarb APN 14 16,434,207 (GRCm38) missense possibly damaging 0.93
IGL01769:Rarb APN 14 16,443,760 (GRCm38) missense probably damaging 0.97
IGL01782:Rarb APN 14 16,434,180 (GRCm38) missense probably damaging 1.00
IGL01866:Rarb APN 14 16,443,751 (GRCm38) missense probably benign 0.17
IGL03299:Rarb APN 14 16,434,168 (GRCm38) missense probably damaging 1.00
IGL03134:Rarb UTSW 14 16,436,910 (GRCm38) missense probably damaging 0.99
R0055:Rarb UTSW 14 16,509,066 (GRCm38) missense probably damaging 1.00
R0055:Rarb UTSW 14 16,509,066 (GRCm38) missense probably damaging 1.00
R0849:Rarb UTSW 14 16,434,293 (GRCm38) missense probably damaging 1.00
R1067:Rarb UTSW 14 16,436,769 (GRCm38) missense probably damaging 0.98
R1416:Rarb UTSW 14 16,435,177 (GRCm38) missense possibly damaging 0.82
R2894:Rarb UTSW 14 16,435,146 (GRCm38) missense probably damaging 1.00
R4637:Rarb UTSW 14 16,574,875 (GRCm38) missense possibly damaging 0.51
R4950:Rarb UTSW 14 16,432,085 (GRCm38) unclassified probably benign
R5420:Rarb UTSW 14 16,434,249 (GRCm38) missense possibly damaging 0.89
R5456:Rarb UTSW 14 16,436,843 (GRCm38) missense probably damaging 1.00
R5635:Rarb UTSW 14 16,443,788 (GRCm38) missense probably damaging 1.00
R5689:Rarb UTSW 14 16,434,177 (GRCm38) missense probably damaging 1.00
R5708:Rarb UTSW 14 16,548,545 (GRCm38) missense probably damaging 0.99
R5819:Rarb UTSW 14 16,443,820 (GRCm38) missense possibly damaging 0.68
R5935:Rarb UTSW 14 16,434,264 (GRCm38) missense probably damaging 1.00
R6264:Rarb UTSW 14 16,818,819 (GRCm38) missense probably benign 0.31
R6823:Rarb UTSW 14 16,443,824 (GRCm38) missense probably damaging 1.00
R6975:Rarb UTSW 14 16,574,942 (GRCm38) missense possibly damaging 0.92
R7295:Rarb UTSW 14 16,508,932 (GRCm38) critical splice donor site probably null
R7402:Rarb UTSW 14 16,548,419 (GRCm38) missense probably damaging 1.00
R7849:Rarb UTSW 14 16,548,473 (GRCm38) missense probably damaging 1.00
R8471:Rarb UTSW 14 16,548,456 (GRCm38) unclassified probably benign
R8833:Rarb UTSW 14 16,819,015 (GRCm38) unclassified probably benign
R8835:Rarb UTSW 14 16,575,011 (GRCm38) missense probably benign 0.23
R8896:Rarb UTSW 14 16,436,804 (GRCm38) missense probably damaging 1.00
R9011:Rarb UTSW 14 16,435,140 (GRCm38) missense probably damaging 0.98
R9090:Rarb UTSW 14 16,435,235 (GRCm38) nonsense probably null
R9184:Rarb UTSW 14 16,818,882 (GRCm38) start gained probably benign
R9184:Rarb UTSW 14 16,818,881 (GRCm38) start gained probably benign
R9271:Rarb UTSW 14 16,435,235 (GRCm38) nonsense probably null
R9574:Rarb UTSW 14 16,574,858 (GRCm38) missense probably damaging 0.96
X0065:Rarb UTSW 14 16,434,303 (GRCm38) missense possibly damaging 0.89
Z1177:Rarb UTSW 14 16,818,725 (GRCm38) missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGTCCACTGCCAGGATGAGGATAC -3'
(R):5'- TTCCTCTATCAGCAGACTGAGCCC -3'

Sequencing Primer
(F):5'- CACTGTCTGTCAGCTAGGGAG -3'
(R):5'- CATCCCAAGGTGGGTTCTG -3'
Posted On 2014-02-18