Incidental Mutation 'R1315:C1qtnf12'
ID157519
Institutional Source Beutler Lab
Gene Symbol C1qtnf12
Ensembl Gene ENSMUSG00000023571
Gene NameC1q and tumor necrosis factor related 12
Synonymsalipolin, C1qdc2, Fam132a, 1110035L05Rik
MMRRC Submission 039381-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1315 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location155962318-155966629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 155965874 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 223 (E223K)
Ref Sequence ENSEMBL: ENSMUSP00000024338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024338]
Predicted Effect probably damaging
Transcript: ENSMUST00000024338
AA Change: E223K

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024338
Gene: ENSMUSG00000023571
AA Change: E223K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 94 118 N/A INTRINSIC
Blast:TNF 168 305 1e-17 BLAST
SCOP:d1gr3a_ 192 306 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149558
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ecd A G 14: 20,337,060 V202A probably benign Het
Golgb1 T C 16: 36,914,900 M1503T probably benign Het
Kif23 G A 9: 61,923,988 probably null Het
Muc5ac C T 7: 141,807,323 T1457I probably damaging Het
Olfr1058 C A 2: 86,386,174 M81I possibly damaging Het
Osbpl2 T C 2: 180,148,602 L223P probably damaging Het
Ppip5k1 T C 2: 121,312,005 D1301G probably benign Het
Rrp1b T C 17: 32,056,639 F387L probably benign Het
Sltm T C 9: 70,543,065 V49A probably benign Het
Spdl1 T A 11: 34,813,407 K533M unknown Het
Wnt8b T C 19: 44,512,023 C350R probably damaging Het
Other mutations in C1qtnf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:C1qtnf12 APN 4 155966429 missense possibly damaging 0.93
IGL01832:C1qtnf12 APN 4 155965866 missense probably damaging 1.00
IGL02015:C1qtnf12 APN 4 155962744 unclassified probably benign
IGL03053:C1qtnf12 APN 4 155966464 missense probably damaging 0.99
R1313:C1qtnf12 UTSW 4 155965874 missense probably damaging 0.96
R1313:C1qtnf12 UTSW 4 155965874 missense probably damaging 0.96
R1316:C1qtnf12 UTSW 4 155965874 missense probably damaging 0.96
R1412:C1qtnf12 UTSW 4 155962733 missense probably benign
R1487:C1qtnf12 UTSW 4 155965874 missense probably damaging 0.96
R1828:C1qtnf12 UTSW 4 155965703 critical splice donor site probably null
R2146:C1qtnf12 UTSW 4 155966465 missense probably benign 0.01
R2147:C1qtnf12 UTSW 4 155966465 missense probably benign 0.01
R2148:C1qtnf12 UTSW 4 155966465 missense probably benign 0.01
R2150:C1qtnf12 UTSW 4 155966465 missense probably benign 0.01
R3786:C1qtnf12 UTSW 4 155965899 missense probably damaging 1.00
R6859:C1qtnf12 UTSW 4 155965613 missense probably damaging 1.00
R7252:C1qtnf12 UTSW 4 155962615 missense unknown
Z1177:C1qtnf12 UTSW 4 155965649 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGTCACCTCCTAATTTCCACAG -3'
(R):5'- TTGCTCTCCAGACCTGATACAGCC -3'

Sequencing Primer
(F):5'- TCCTTGGGCCGATTCACAG -3'
(R):5'- TGATACAGCCTCCAGGGAC -3'
Posted On2014-02-18