Incidental Mutation 'R1316:Tiparp'
ID157538
Institutional Source Beutler Lab
Gene Symbol Tiparp
Ensembl Gene ENSMUSG00000034640
Gene NameTCDD-inducible poly(ADP-ribose) polymerase
SynonymsPARP7, PARP-7, DDF1
MMRRC Submission 039382-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.844) question?
Stock #R1316 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location65528410-65555518 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 65553351 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 587 (F587C)
Ref Sequence ENSEMBL: ENSMUSP00000048051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047906]
Predicted Effect probably damaging
Transcript: ENSMUST00000047906
AA Change: F587C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048051
Gene: ENSMUSG00000034640
AA Change: F587C

DomainStartEndE-ValueType
Blast:ZnF_C3H1 238 264 2e-8 BLAST
Pfam:PARP 463 650 2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154094
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(ADP-ribose) polymerase superfamily. Studies of the mouse ortholog have shown that the encoded protein catalyzes histone poly(ADP-ribosyl)ation and may be involved in T-cell function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal lethality, skeletal and craniofacial defects, kidney defects and embryonic hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,299,670 V957A probably benign Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Cmpk1 A G 4: 114,971,290 probably benign Het
Col11a1 G A 3: 114,138,970 probably null Het
Ears2 T C 7: 122,046,682 T337A probably benign Het
Erbin T C 13: 103,841,234 K605R possibly damaging Het
Irs3 T C 5: 137,644,441 E245G probably damaging Het
Limch1 T C 5: 66,999,243 I223T probably damaging Het
Lrp1b T C 2: 40,702,804 T3768A probably benign Het
Notch4 G A 17: 34,567,470 D195N probably damaging Het
Olfr1463 T C 19: 13,234,439 F63S probably damaging Het
Olfr52 T C 2: 86,181,365 S249G probably benign Het
Olfr843 T A 9: 19,248,739 Q220L probably benign Het
Olfr875 T C 9: 37,772,743 F28S possibly damaging Het
Podxl2 A G 6: 88,849,217 L369P probably benign Het
Rnf149 A G 1: 39,565,320 *45Q probably null Het
Slc4a11 T A 2: 130,686,151 E528V probably benign Het
Slc9a1 A G 4: 133,422,247 R795G possibly damaging Het
Slco6d1 A T 1: 98,466,793 M401L probably benign Het
Vmn2r120 T C 17: 57,525,939 Q80R probably benign Het
Other mutations in Tiparp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Tiparp APN 3 65532109 missense probably damaging 1.00
IGL01448:Tiparp APN 3 65552609 nonsense probably null
IGL01452:Tiparp APN 3 65552609 nonsense probably null
IGL01454:Tiparp APN 3 65552609 nonsense probably null
IGL01456:Tiparp APN 3 65552609 nonsense probably null
IGL01463:Tiparp APN 3 65552609 nonsense probably null
IGL01467:Tiparp APN 3 65552609 nonsense probably null
IGL01468:Tiparp APN 3 65552609 nonsense probably null
IGL01470:Tiparp APN 3 65552609 nonsense probably null
IGL01476:Tiparp APN 3 65552609 nonsense probably null
IGL01481:Tiparp APN 3 65552609 nonsense probably null
IGL01590:Tiparp APN 3 65531976 missense probably benign 0.14
IGL01684:Tiparp APN 3 65553333 missense probably damaging 0.99
IGL02322:Tiparp APN 3 65532020 nonsense probably null
IGL02572:Tiparp APN 3 65531889 missense probably benign 0.01
R0401:Tiparp UTSW 3 65531436 missense probably benign 0.06
R0674:Tiparp UTSW 3 65553165 missense probably benign 0.03
R1766:Tiparp UTSW 3 65532049 missense probably damaging 1.00
R2140:Tiparp UTSW 3 65529252 intron probably benign
R2568:Tiparp UTSW 3 65553130 nonsense probably null
R4533:Tiparp UTSW 3 65546347 missense probably benign 0.05
R4751:Tiparp UTSW 3 65552804 missense probably damaging 1.00
R4812:Tiparp UTSW 3 65552769 missense possibly damaging 0.94
R5268:Tiparp UTSW 3 65547565 missense possibly damaging 0.72
R5622:Tiparp UTSW 3 65547525 missense probably benign 0.00
R5693:Tiparp UTSW 3 65553492 missense possibly damaging 0.89
R5765:Tiparp UTSW 3 65531350 missense possibly damaging 0.69
R6061:Tiparp UTSW 3 65553243 missense probably damaging 0.98
R6875:Tiparp UTSW 3 65531642 missense probably benign 0.01
R7123:Tiparp UTSW 3 65553527 missense probably damaging 1.00
R8023:Tiparp UTSW 3 65531803 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTTCATCCAAGTGCCTGTTTCTGC -3'
(R):5'- ACCTGCTACAAATGCTGGATTGAGTT -3'

Sequencing Primer
(F):5'- AATGTCTGGCCGTGACAG -3'
(R):5'- GGAAACAGTGTTACTGACTTCTTC -3'
Posted On2014-02-18