Mutagenetix > Incidental Mutations

Incidental Mutation 'R1316:5830411N06Rik'

157549

Institutional Source

Beutler Lab

Gene Symbol

5830411N06Rik

Ensembl Gene

ENSMUSG00000054672

Gene Name

RIKEN cDNA 5830411N06 gene

Synonyms

Scart2

MMRRC Submission

039382-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1316 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

140247284-140300736 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 140299670 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 957 (V957A)

Ref Sequence

ENSEMBL: ENSMUSP00000091520 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093984] [ENSMUST00000164583]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000059882

SMART Domains

Protein: ENSMUSP00000061346
Gene: ENSMUSG00000054672

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
SR	29	130	1.49e-18	SMART
SR	137	233	2.53e-4	SMART
SR	238	336	1.65e-34	SMART
SR	340	440	4.53e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000093984
AA Change: V957A

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000091520
Gene: ENSMUSG00000054672
AA Change: V957A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
SR	29	130	1.49e-18	SMART
SR	137	233	2.53e-4	SMART
SR	238	336	1.65e-34	SMART
SR	340	440	4.53e-32	SMART
SR	446	546	8.78e-30	SMART
SR	551	651	1.26e-53	SMART
SR	656	756	2.88e-16	SMART
SR	783	883	7.62e-48	SMART
transmembrane domain	903	925	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164583
AA Change: V1073A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000131905
Gene: ENSMUSG00000054672
AA Change: V1073A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
SR	29	130	1.49e-18	SMART
SR	137	233	2.53e-4	SMART
Blast:SR	291	349	5e-12	BLAST
SR	354	452	1.65e-34	SMART
SR	456	556	4.53e-32	SMART
SR	562	662	8.78e-30	SMART
SR	667	767	1.26e-53	SMART
SR	772	872	2.88e-16	SMART
SR	899	999	7.62e-48	SMART
transmembrane domain	1019	1041	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210212

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211749

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 90.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
C1qtnf12	G	A	4: 155,965,874	E223K	probably damaging	Het
Cmpk1	A	G	4: 114,971,290		probably benign	Het
Col11a1	G	A	3: 114,138,970		probably null	Het
Ears2	T	C	7: 122,046,682	T337A	probably benign	Het
Erbin	T	C	13: 103,841,234	K605R	possibly damaging	Het
Irs3	T	C	5: 137,644,441	E245G	probably damaging	Het
Limch1	T	C	5: 66,999,243	I223T	probably damaging	Het
Lrp1b	T	C	2: 40,702,804	T3768A	probably benign	Het
Notch4	G	A	17: 34,567,470	D195N	probably damaging	Het
Olfr1463	T	C	19: 13,234,439	F63S	probably damaging	Het
Olfr52	T	C	2: 86,181,365	S249G	probably benign	Het
Olfr843	T	A	9: 19,248,739	Q220L	probably benign	Het
Olfr875	T	C	9: 37,772,743	F28S	possibly damaging	Het
Podxl2	A	G	6: 88,849,217	L369P	probably benign	Het
Rnf149	A	G	1: 39,565,320	*45Q	probably null	Het
Slc4a11	T	A	2: 130,686,151	E528V	probably benign	Het
Slc9a1	A	G	4: 133,422,247	R795G	possibly damaging	Het
Slco6d1	A	T	1: 98,466,793	M401L	probably benign	Het
Tiparp	T	G	3: 65,553,351	F587C	probably damaging	Het
Vmn2r120	T	C	17: 57,525,939	Q80R	probably benign	Het

Other mutations in 5830411N06Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:5830411N06Rik	APN	7	140294842	missense	probably damaging	0.99
IGL01101:5830411N06Rik	APN	7	140296104	missense	probably benign	0.35
IGL01120:5830411N06Rik	APN	7	140296559	missense	probably benign	0.02
IGL01958:5830411N06Rik	APN	7	140274127	missense	probably damaging	1.00
IGL02150:5830411N06Rik	APN	7	140297859	missense	possibly damaging	0.84
IGL02193:5830411N06Rik	APN	7	140249000	missense	probably benign	0.17
IGL02239:5830411N06Rik	APN	7	140295843	missense	probably damaging	1.00
IGL02335:5830411N06Rik	APN	7	140296540	missense	probably damaging	1.00
IGL02569:5830411N06Rik	APN	7	140298362	missense	probably benign	0.01
IGL02993:5830411N06Rik	APN	7	140296573	missense	probably benign	0.07
IGL03261:5830411N06Rik	APN	7	140294833	missense	probably benign	0.00
IGL03365:5830411N06Rik	APN	7	140296769	missense	probably damaging	1.00
IGL03399:5830411N06Rik	APN	7	140247956	missense	probably benign	0.00
IGL03052:5830411N06Rik	UTSW	7	140248914	missense	probably damaging	1.00
PIT4791001:5830411N06Rik	UTSW	7	140274062	missense	possibly damaging	0.53
R0021:5830411N06Rik	UTSW	7	140296397	missense	probably benign	0.15
R0021:5830411N06Rik	UTSW	7	140296397	missense	probably benign	0.15
R0347:5830411N06Rik	UTSW	7	140297854	missense	probably damaging	1.00
R0374:5830411N06Rik	UTSW	7	140248961	missense	probably damaging	1.00
R0639:5830411N06Rik	UTSW	7	140247959	missense	probably benign	0.01
R0667:5830411N06Rik	UTSW	7	140261537	missense	possibly damaging	0.73
R0789:5830411N06Rik	UTSW	7	140248220	missense	probably damaging	1.00
R0959:5830411N06Rik	UTSW	7	140294791	missense	probably damaging	1.00
R1764:5830411N06Rik	UTSW	7	140297265	missense	probably benign	0.00
R2247:5830411N06Rik	UTSW	7	140249129	missense	probably null	0.96
R2379:5830411N06Rik	UTSW	7	140299769	missense	probably benign	0.15
R4112:5830411N06Rik	UTSW	7	140298368	nonsense	probably null
R4114:5830411N06Rik	UTSW	7	140297910	missense	probably damaging	1.00
R4346:5830411N06Rik	UTSW	7	140247965	missense	probably damaging	0.97
R4836:5830411N06Rik	UTSW	7	140299108	missense	probably benign
R4956:5830411N06Rik	UTSW	7	140298362	missense	probably benign	0.00
R5208:5830411N06Rik	UTSW	7	140298036	missense	probably benign	0.00
R5571:5830411N06Rik	UTSW	7	140249123	missense	probably damaging	1.00
R5583:5830411N06Rik	UTSW	7	140296826	missense	probably damaging	1.00
R5645:5830411N06Rik	UTSW	7	140248940	missense	possibly damaging	0.95
R6183:5830411N06Rik	UTSW	7	140296034	missense	possibly damaging	0.82
R6995:5830411N06Rik	UTSW	7	140261601	missense	probably benign
R7436:5830411N06Rik	UTSW	7	140261607	missense	probably benign
R7621:5830411N06Rik	UTSW	7	140296829	missense	probably damaging	1.00
R7662:5830411N06Rik	UTSW	7	140294812	missense	possibly damaging	0.58
R7669:5830411N06Rik	UTSW	7	140296321	missense	possibly damaging	0.47
R7686:5830411N06Rik	UTSW	7	140249052	missense	probably benign	0.00
R7985:5830411N06Rik	UTSW	7	140296893	missense	probably damaging	1.00
R8330:5830411N06Rik	UTSW	7	140296318	nonsense	probably null
R8843:5830411N06Rik	UTSW	7	140249000	missense	possibly damaging	0.93
R8888:5830411N06Rik	UTSW	7	140261619	missense	possibly damaging	0.93
R8895:5830411N06Rik	UTSW	7	140261619	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- ACATTTGAGCATGTGTCCTGAGCAG -3'
(R):5'- CAGCAGAAGGCTCTGAAGACCATC -3'

Sequencing Primer
(F):5'- TGAGCAGTGGAGTCCCAG -3'
(R):5'- gagttcaattcccagcaacc -3'

Posted On

2014-02-18