Incidental Mutation 'R1316:Erbin'
ID157552
Institutional Source Beutler Lab
Gene Symbol Erbin
Ensembl Gene ENSMUSG00000021709
Gene NameErbb2 interacting protein
Synonyms1700028E05Rik, Erbb2ip, Erbin
MMRRC Submission 039382-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1316 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location103818787-103920514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103841234 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 605 (K605R)
Ref Sequence ENSEMBL: ENSMUSP00000022222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022222] [ENSMUST00000053927] [ENSMUST00000091269] [ENSMUST00000169083] [ENSMUST00000188997] [ENSMUST00000191275]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022222
AA Change: K605R

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022222
Gene: ENSMUSG00000021709
AA Change: K605R

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1294 1374 3.6e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000053927
AA Change: K605R

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057956
Gene: ENSMUSG00000021709
AA Change: K605R

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1368 1448 3.6e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000091269
AA Change: K605R

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088813
Gene: ENSMUSG00000021709
AA Change: K605R

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1320 1400 3.6e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169083
AA Change: K605R

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127607
Gene: ENSMUSG00000021709
AA Change: K605R

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1329 1409 3.6e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188997
AA Change: K605R

PolyPhen 2 Score 0.318 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140931
Gene: ENSMUSG00000021709
AA Change: K605R

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1212 1292 3.6e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189323
Predicted Effect possibly damaging
Transcript: ENSMUST00000191275
AA Change: K605R

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140536
Gene: ENSMUSG00000021709
AA Change: K605R

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1368 1448 3.6e-16 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat and PDZ domain (LAP) family. The encoded protein contains 17 leucine-rich repeats and one PDZ domain. It binds to the unphosphorylated form of the ERBB2 protein and regulates ERBB2 function and localization. It has also been shown to affect the Ras signaling pathway by disrupting Ras-Raf interaction. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null or gene trapped allele exhibit impaired myelination, reduced nerve conduction, and hyporesponsiveness to tactile stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,299,670 V957A probably benign Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Cmpk1 A G 4: 114,971,290 probably benign Het
Col11a1 G A 3: 114,138,970 probably null Het
Ears2 T C 7: 122,046,682 T337A probably benign Het
Irs3 T C 5: 137,644,441 E245G probably damaging Het
Limch1 T C 5: 66,999,243 I223T probably damaging Het
Lrp1b T C 2: 40,702,804 T3768A probably benign Het
Notch4 G A 17: 34,567,470 D195N probably damaging Het
Olfr1463 T C 19: 13,234,439 F63S probably damaging Het
Olfr52 T C 2: 86,181,365 S249G probably benign Het
Olfr843 T A 9: 19,248,739 Q220L probably benign Het
Olfr875 T C 9: 37,772,743 F28S possibly damaging Het
Podxl2 A G 6: 88,849,217 L369P probably benign Het
Rnf149 A G 1: 39,565,320 *45Q probably null Het
Slc4a11 T A 2: 130,686,151 E528V probably benign Het
Slc9a1 A G 4: 133,422,247 R795G possibly damaging Het
Slco6d1 A T 1: 98,466,793 M401L probably benign Het
Tiparp T G 3: 65,553,351 F587C probably damaging Het
Vmn2r120 T C 17: 57,525,939 Q80R probably benign Het
Other mutations in Erbin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Erbin APN 13 103834012 missense probably damaging 1.00
IGL01404:Erbin APN 13 103839464 missense probably damaging 1.00
IGL01455:Erbin APN 13 103859387 missense probably damaging 1.00
IGL01871:Erbin APN 13 103834766 missense probably damaging 0.98
IGL01930:Erbin APN 13 103841172 missense probably damaging 1.00
IGL02112:Erbin APN 13 103862336 missense probably benign 0.12
IGL02736:Erbin APN 13 103839395 missense probably damaging 1.00
IGL03149:Erbin APN 13 103841163 missense possibly damaging 0.82
IGL03169:Erbin APN 13 103841232 missense possibly damaging 0.93
IGL02802:Erbin UTSW 13 103868130 missense probably damaging 1.00
PIT1430001:Erbin UTSW 13 103859509 missense probably damaging 1.00
R0329:Erbin UTSW 13 103868865 missense probably damaging 1.00
R0330:Erbin UTSW 13 103868865 missense probably damaging 1.00
R0492:Erbin UTSW 13 103834358 missense probably damaging 0.98
R0508:Erbin UTSW 13 103834027 missense probably damaging 1.00
R0589:Erbin UTSW 13 103886287 missense probably damaging 1.00
R1103:Erbin UTSW 13 103886202 missense probably benign 0.00
R1139:Erbin UTSW 13 103884253 missense probably damaging 1.00
R1675:Erbin UTSW 13 103841178 missense probably damaging 1.00
R1698:Erbin UTSW 13 103833731 missense possibly damaging 0.91
R1727:Erbin UTSW 13 103827968 missense probably benign 0.01
R1745:Erbin UTSW 13 103839449 missense probably damaging 1.00
R1746:Erbin UTSW 13 103850831 missense probably damaging 1.00
R1764:Erbin UTSW 13 103843451 splice site probably benign
R1828:Erbin UTSW 13 103860069 critical splice donor site probably null
R1840:Erbin UTSW 13 103834947 missense probably benign 0.01
R1987:Erbin UTSW 13 103886203 missense probably benign 0.36
R1992:Erbin UTSW 13 103833713 missense probably benign 0.33
R2013:Erbin UTSW 13 103857533 missense probably damaging 1.00
R2025:Erbin UTSW 13 103830195 missense probably benign 0.01
R2056:Erbin UTSW 13 103830316 missense probably benign 0.27
R2171:Erbin UTSW 13 103834958 missense probably benign 0.00
R2366:Erbin UTSW 13 103844909 missense probably damaging 1.00
R2897:Erbin UTSW 13 103886197 missense probably damaging 1.00
R3912:Erbin UTSW 13 103862287 missense probably benign 0.35
R3912:Erbin UTSW 13 103886338 splice site probably benign
R4073:Erbin UTSW 13 103860111 missense probably damaging 1.00
R4458:Erbin UTSW 13 103833557 missense probably damaging 1.00
R4465:Erbin UTSW 13 103844885 missense probably benign 0.05
R4525:Erbin UTSW 13 103857092 missense probably benign
R4780:Erbin UTSW 13 103884206 missense probably damaging 1.00
R4877:Erbin UTSW 13 103850838 missense probably damaging 0.99
R4879:Erbin UTSW 13 103834774 missense probably benign 0.05
R5396:Erbin UTSW 13 103857409 critical splice donor site probably null
R5898:Erbin UTSW 13 103839305 critical splice donor site probably null
R5955:Erbin UTSW 13 103830192 missense probably benign 0.40
R6073:Erbin UTSW 13 103844921 nonsense probably null
R6107:Erbin UTSW 13 103833892 missense probably benign 0.06
R6257:Erbin UTSW 13 103862288 missense probably benign 0.35
R6294:Erbin UTSW 13 103857056 missense probably benign 0.36
R6358:Erbin UTSW 13 103845565 missense probably damaging 1.00
R6476:Erbin UTSW 13 103841247 missense probably damaging 1.00
R6485:Erbin UTSW 13 103868113 missense probably damaging 1.00
R6631:Erbin UTSW 13 103824892 missense probably benign 0.02
R6735:Erbin UTSW 13 103884210 missense probably damaging 1.00
R6736:Erbin UTSW 13 103834766 missense possibly damaging 0.72
R6749:Erbin UTSW 13 103834377 missense probably damaging 1.00
R7290:Erbin UTSW 13 103862326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAACAAACTCTGCATGGGAGTGG -3'
(R):5'- TAGGCAAAGGCTCTGTTGAGGGAC -3'

Sequencing Primer
(F):5'- AGTGGAGAGGACCTACCAATC -3'
(R):5'- GAGTCATGCAGCTTTGTCAAC -3'
Posted On2014-02-18