Incidental Mutation 'R1316:Olfr1463'
ID157556
Institutional Source Beutler Lab
Gene Symbol Olfr1463
Ensembl Gene ENSMUSG00000096365
Gene Nameolfactory receptor 1463
SynonymsMOR202-29P, GA_x6K02T2RE5P-3560863-3561795
MMRRC Submission 039382-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1316 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13231328-13236400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13234439 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 63 (F63S)
Ref Sequence ENSEMBL: ENSMUSP00000146566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064102] [ENSMUST00000207246]
Predicted Effect probably damaging
Transcript: ENSMUST00000064102
AA Change: F63S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070872
Gene: ENSMUSG00000096365
AA Change: F63S

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 1e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 306 3.2e-6 PFAM
Pfam:7tm_1 42 291 1.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207246
AA Change: F63S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,299,670 V957A probably benign Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Cmpk1 A G 4: 114,971,290 probably benign Het
Col11a1 G A 3: 114,138,970 probably null Het
Ears2 T C 7: 122,046,682 T337A probably benign Het
Erbin T C 13: 103,841,234 K605R possibly damaging Het
Irs3 T C 5: 137,644,441 E245G probably damaging Het
Limch1 T C 5: 66,999,243 I223T probably damaging Het
Lrp1b T C 2: 40,702,804 T3768A probably benign Het
Notch4 G A 17: 34,567,470 D195N probably damaging Het
Olfr52 T C 2: 86,181,365 S249G probably benign Het
Olfr843 T A 9: 19,248,739 Q220L probably benign Het
Olfr875 T C 9: 37,772,743 F28S possibly damaging Het
Podxl2 A G 6: 88,849,217 L369P probably benign Het
Rnf149 A G 1: 39,565,320 *45Q probably null Het
Slc4a11 T A 2: 130,686,151 E528V probably benign Het
Slc9a1 A G 4: 133,422,247 R795G possibly damaging Het
Slco6d1 A T 1: 98,466,793 M401L probably benign Het
Tiparp T G 3: 65,553,351 F587C probably damaging Het
Vmn2r120 T C 17: 57,525,939 Q80R probably benign Het
Other mutations in Olfr1463
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Olfr1463 APN 19 13234739 missense probably benign 0.01
IGL02596:Olfr1463 APN 19 13234399 missense probably damaging 1.00
IGL03030:Olfr1463 APN 19 13235054 missense probably damaging 0.98
IGL03232:Olfr1463 APN 19 13234977 nonsense probably null
IGL03380:Olfr1463 APN 19 13235001 missense probably benign 0.00
PIT4382001:Olfr1463 UTSW 19 13234895 missense probably damaging 1.00
PIT4519001:Olfr1463 UTSW 19 13234852 missense probably benign 0.00
R0652:Olfr1463 UTSW 19 13234535 missense possibly damaging 0.80
R0658:Olfr1463 UTSW 19 13235060 missense possibly damaging 0.94
R1181:Olfr1463 UTSW 19 13234831 missense probably benign 0.07
R1239:Olfr1463 UTSW 19 13234676 missense possibly damaging 0.80
R1465:Olfr1463 UTSW 19 13234901 missense possibly damaging 0.61
R1465:Olfr1463 UTSW 19 13234901 missense possibly damaging 0.61
R1900:Olfr1463 UTSW 19 13234913 missense possibly damaging 0.54
R1927:Olfr1463 UTSW 19 13235029 missense probably damaging 1.00
R2239:Olfr1463 UTSW 19 13234721 missense probably benign 0.00
R2380:Olfr1463 UTSW 19 13234721 missense probably benign 0.00
R3760:Olfr1463 UTSW 19 13234886 missense probably damaging 1.00
R3765:Olfr1463 UTSW 19 13234431 missense probably damaging 1.00
R3835:Olfr1463 UTSW 19 13234739 missense probably benign 0.18
R4690:Olfr1463 UTSW 19 13234768 missense possibly damaging 0.91
R4907:Olfr1463 UTSW 19 13234793 missense probably damaging 1.00
R5444:Olfr1463 UTSW 19 13234958 missense probably benign 0.28
R5465:Olfr1463 UTSW 19 13234688 missense probably benign 0.00
R6083:Olfr1463 UTSW 19 13234525 missense probably benign 0.01
R6259:Olfr1463 UTSW 19 13234421 missense probably damaging 0.98
R6324:Olfr1463 UTSW 19 13235104 missense possibly damaging 0.95
R6561:Olfr1463 UTSW 19 13235030 missense probably damaging 1.00
R6845:Olfr1463 UTSW 19 13234633 missense probably damaging 1.00
R7260:Olfr1463 UTSW 19 13235024 missense probably damaging 0.98
R7843:Olfr1463 UTSW 19 13234537 missense possibly damaging 0.48
X0063:Olfr1463 UTSW 19 13234635 missense probably damaging 1.00
X0067:Olfr1463 UTSW 19 13234697 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCACATGAAATTCACATCAGTGTCCAG -3'
(R):5'- TGAGGCCAACAGGTAATTTTCCACAG -3'

Sequencing Primer
(F):5'- CATTGCTGATTTGTTAGATGACACC -3'
(R):5'- CAGGTAATTTTCCACAGTAGCAAAGG -3'
Posted On2014-02-18