Incidental Mutation 'R1317:Cryba2'
ID157557
Institutional Source Beutler Lab
Gene Symbol Cryba2
Ensembl Gene ENSMUSG00000006546
Gene Namecrystallin, beta A2
SynonymsE130107M19Rik
MMRRC Submission 039383-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R1317 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location74889934-74893143 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 74890676 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000006721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006721] [ENSMUST00000133833]
Predicted Effect probably null
Transcript: ENSMUST00000006721
SMART Domains Protein: ENSMUSP00000006721
Gene: ENSMUSG00000006546

DomainStartEndE-ValueType
XTALbg 13 98 1.64e-37 SMART
XTALbg 107 195 8.79e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133833
SMART Domains Protein: ENSMUSP00000140298
Gene: ENSMUSG00000006546

DomainStartEndE-ValueType
XTALbg 13 54 3.2e-3 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of the vertebrate eye, which function to maintain the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also defined as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group but absent in the acidic group). Beta-crystallins form aggregates of different sizes and are able to form homodimers through self-association or heterodimers with other beta-crystallins. This gene is a beta acidic group member. Three alternatively spliced transcript variants encoding identical proteins have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for an ENU-induced allele exhibit small lens and cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Afdn A G 17: 13,846,273 T576A probably benign Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Ccdc7b A T 8: 129,136,646 H223L probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Hnrnpu G A 1: 178,330,257 probably benign Het
Ifi209 A G 1: 173,637,463 D53G possibly damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Jag2 T A 12: 112,914,501 M537L probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mt1 T C 8: 94,180,153 probably benign Het
Myo15b C A 11: 115,883,634 P2024Q probably null Het
Nphs1 C T 7: 30,481,831 probably benign Het
Rbm27 G A 18: 42,324,051 probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Slc25a23 T C 17: 57,053,888 K179E possibly damaging Het
Smad5 T C 13: 56,736,071 probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Trim30b T A 7: 104,357,335 T105S possibly damaging Het
Tspan32 A G 7: 143,017,591 M159V probably benign Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Zbtb1 A G 12: 76,386,799 S520G probably benign Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Other mutations in Cryba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Cryba2 APN 1 74890561 missense possibly damaging 0.64
IGL02141:Cryba2 APN 1 74892784 missense probably benign 0.11
P0035:Cryba2 UTSW 1 74890012 missense probably damaging 1.00
R0518:Cryba2 UTSW 1 74890125 missense possibly damaging 0.91
R1079:Cryba2 UTSW 1 74890558 missense probably damaging 1.00
R4494:Cryba2 UTSW 1 74890630 missense probably damaging 1.00
R4666:Cryba2 UTSW 1 74890048 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCTGAGCCTGGTTTCTACATGCAC -3'
(R):5'- CCGATGGGGCAAACTCCTGAAATG -3'

Sequencing Primer
(F):5'- ACACGTCATGTTGTCGCC -3'
(R):5'- ACTCCTGAAATGCCTGAGAG -3'
Posted On2014-02-18