Incidental Mutation 'R1317:Irf6'
ID157560
Institutional Source Beutler Lab
Gene Symbol Irf6
Ensembl Gene ENSMUSG00000026638
Gene Nameinterferon regulatory factor 6
SynonymsE230028I05Rik
MMRRC Submission 039383-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.833) question?
Stock #R1317 (G1)
Quality Score224
Status Validated
Chromosome1
Chromosomal Location193153111-193172023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 193169301 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 400 (R400H)
Ref Sequence ENSEMBL: ENSMUSP00000075839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076521] [ENSMUST00000110831] [ENSMUST00000160077] [ENSMUST00000160822] [ENSMUST00000161235] [ENSMUST00000178744] [ENSMUST00000191613] [ENSMUST00000192189] [ENSMUST00000193307]
Predicted Effect probably damaging
Transcript: ENSMUST00000076521
AA Change: R400H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075839
Gene: ENSMUSG00000026638
AA Change: R400H

DomainStartEndE-ValueType
IRF 3 116 1.98e-59 SMART
low complexity region 135 151 N/A INTRINSIC
Blast:IRF 158 189 6e-8 BLAST
IRF-3 223 407 3.92e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110831
SMART Domains Protein: ENSMUSP00000106455
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 13 263 1.4e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138826
Predicted Effect probably benign
Transcript: ENSMUST00000160077
SMART Domains Protein: ENSMUSP00000141934
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 13 163 6.7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160822
SMART Domains Protein: ENSMUSP00000124546
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 15 263 2.7e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161235
SMART Domains Protein: ENSMUSP00000124191
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 13 263 1.4e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178744
SMART Domains Protein: ENSMUSP00000136653
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 13 263 1.4e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191613
SMART Domains Protein: ENSMUSP00000141799
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 13 70 7.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192189
Predicted Effect probably benign
Transcript: ENSMUST00000193307
SMART Domains Protein: ENSMUSP00000142273
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 13 84 3.4e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193772
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the interferon regulatory transcription factor (IRF) family. Family members share a highly-conserved N-terminal helix-turn-helix DNA-binding domain and a less conserved C-terminal protein-binding domain. The encoded protein may be a transcriptional activator. Mutations in this gene can cause van der Woude syndrome and popliteal pterygium syndrome. Mutations in this gene are also associated with non-syndromic orofacial cleft type 6. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2011]
PHENOTYPE: Mice with mutations of Irf6 display craniofacial, limb, and skin defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Afdn A G 17: 13,846,273 T576A probably benign Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Ccdc7b A T 8: 129,136,646 H223L probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cryba2 G T 1: 74,890,676 probably null Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Hnrnpu G A 1: 178,330,257 probably benign Het
Ifi209 A G 1: 173,637,463 D53G possibly damaging Het
Jag2 T A 12: 112,914,501 M537L probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mt1 T C 8: 94,180,153 probably benign Het
Myo15b C A 11: 115,883,634 P2024Q probably null Het
Nphs1 C T 7: 30,481,831 probably benign Het
Rbm27 G A 18: 42,324,051 probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Slc25a23 T C 17: 57,053,888 K179E possibly damaging Het
Smad5 T C 13: 56,736,071 probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Trim30b T A 7: 104,357,335 T105S possibly damaging Het
Tspan32 A G 7: 143,017,591 M159V probably benign Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Zbtb1 A G 12: 76,386,799 S520G probably benign Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Other mutations in Irf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03269:Irf6 APN 1 193162598 splice site probably benign
R0068:Irf6 UTSW 1 193165759 unclassified probably benign
R1413:Irf6 UTSW 1 193169305 missense probably benign 0.22
R1761:Irf6 UTSW 1 193169301 missense probably damaging 1.00
R1856:Irf6 UTSW 1 193167535 missense probably benign 0.32
R3712:Irf6 UTSW 1 193162623 missense probably benign 0.00
R3941:Irf6 UTSW 1 193168549 missense probably benign 0.17
R4717:Irf6 UTSW 1 193167434 splice site probably null
R6461:Irf6 UTSW 1 193167471 missense probably damaging 1.00
R6530:Irf6 UTSW 1 193157349 missense probably damaging 1.00
R6577:Irf6 UTSW 1 193169354 missense probably damaging 1.00
R6883:Irf6 UTSW 1 193167466 missense probably damaging 1.00
R7116:Irf6 UTSW 1 193167597 missense probably damaging 1.00
R7698:Irf6 UTSW 1 193161767 missense probably damaging 1.00
R7887:Irf6 UTSW 1 193167732 missense probably damaging 1.00
R7894:Irf6 UTSW 1 193162713 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ACCAAGATAGGCAGTGGATGCCTC -3'
(R):5'- CAGCTCTCCTGGGTTTGAAGGATG -3'

Sequencing Primer
(F):5'- GAATGATGCTACATCCAGGTTCC -3'
(R):5'- TTTGAAGGATGCGGTACAGC -3'
Posted On2014-02-18