Incidental Mutation 'R1317:Depdc1a'
ID157562
Institutional Source Beutler Lab
Gene Symbol Depdc1a
Ensembl Gene ENSMUSG00000028175
Gene NameDEP domain containing 1a
Synonyms5830484J08Rik
MMRRC Submission 039383-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R1317 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location159495433-159529955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 159523287 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 559 (C559R)
Ref Sequence ENSEMBL: ENSMUSP00000113216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029825] [ENSMUST00000106041] [ENSMUST00000120272]
Predicted Effect probably damaging
Transcript: ENSMUST00000029825
AA Change: C559R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029825
Gene: ENSMUSG00000028175
AA Change: C559R

DomainStartEndE-ValueType
DEP 24 108 3.51e-24 SMART
low complexity region 505 524 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
SCOP:d1f7ca_ 584 680 3e-9 SMART
low complexity region 745 762 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106041
SMART Domains Protein: ENSMUSP00000101656
Gene: ENSMUSG00000028175

DomainStartEndE-ValueType
DEP 24 108 3.51e-24 SMART
Pfam:RhoGAP 251 357 2.3e-11 PFAM
coiled coil region 460 488 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120272
AA Change: C559R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113216
Gene: ENSMUSG00000028175
AA Change: C559R

DomainStartEndE-ValueType
DEP 24 108 3.51e-24 SMART
low complexity region 505 524 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
SCOP:d1f7ca_ 584 680 4e-9 SMART
coiled coil region 737 765 N/A INTRINSIC
Meta Mutation Damage Score 0.2650 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.9%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Afdn A G 17: 13,846,273 T576A probably benign Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Ccdc7b A T 8: 129,136,646 H223L probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cryba2 G T 1: 74,890,676 probably null Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Hnrnpu G A 1: 178,330,257 probably benign Het
Ifi209 A G 1: 173,637,463 D53G possibly damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Jag2 T A 12: 112,914,501 M537L probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mt1 T C 8: 94,180,153 probably benign Het
Myo15b C A 11: 115,883,634 P2024Q probably null Het
Nphs1 C T 7: 30,481,831 probably benign Het
Rbm27 G A 18: 42,324,051 probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Slc25a23 T C 17: 57,053,888 K179E possibly damaging Het
Smad5 T C 13: 56,736,071 probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Trim30b T A 7: 104,357,335 T105S possibly damaging Het
Tspan32 A G 7: 143,017,591 M159V probably benign Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Zbtb1 A G 12: 76,386,799 S520G probably benign Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Other mutations in Depdc1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Depdc1a APN 3 159522738 nonsense probably null
IGL00581:Depdc1a APN 3 159526552 missense probably benign 0.12
IGL00961:Depdc1a APN 3 159523814 missense possibly damaging 0.79
IGL01530:Depdc1a APN 3 159523923 missense probably damaging 1.00
IGL01567:Depdc1a APN 3 159526546 missense probably damaging 1.00
IGL02320:Depdc1a APN 3 159516933 missense probably damaging 0.99
IGL02622:Depdc1a APN 3 159515510 missense probably benign 0.02
IGL02647:Depdc1a APN 3 159522866 missense probably damaging 1.00
P0033:Depdc1a UTSW 3 159516141 missense probably damaging 0.99
P4717OSA:Depdc1a UTSW 3 159522547 missense probably damaging 1.00
P4748:Depdc1a UTSW 3 159522547 missense probably damaging 1.00
R0220:Depdc1a UTSW 3 159523905 missense probably benign 0.06
R0454:Depdc1a UTSW 3 159516900 splice site probably null
R0479:Depdc1a UTSW 3 159520860 missense probably damaging 1.00
R1452:Depdc1a UTSW 3 159526691 missense possibly damaging 0.88
R1567:Depdc1a UTSW 3 159522540 missense possibly damaging 0.86
R1669:Depdc1a UTSW 3 159522924 missense probably benign 0.07
R1751:Depdc1a UTSW 3 159523287 missense probably damaging 1.00
R2332:Depdc1a UTSW 3 159523866 missense probably damaging 1.00
R4023:Depdc1a UTSW 3 159516149 splice site probably null
R4254:Depdc1a UTSW 3 159498487 missense probably damaging 0.99
R4551:Depdc1a UTSW 3 159522584 missense probably damaging 1.00
R4780:Depdc1a UTSW 3 159526706 missense probably benign 0.00
R4782:Depdc1a UTSW 3 159526636 missense probably damaging 1.00
R4866:Depdc1a UTSW 3 159516127 missense probably damaging 0.96
R4981:Depdc1a UTSW 3 159523913 missense probably benign 0.14
R5100:Depdc1a UTSW 3 159515520 missense probably benign 0.06
R5326:Depdc1a UTSW 3 159526649 missense probably damaging 1.00
R5367:Depdc1a UTSW 3 159523954 splice site probably null
R5892:Depdc1a UTSW 3 159526669 missense probably damaging 1.00
R6314:Depdc1a UTSW 3 159498414 missense probably damaging 1.00
R6467:Depdc1a UTSW 3 159516042 missense probably benign 0.00
R6674:Depdc1a UTSW 3 159526707 missense probably benign 0.00
R7061:Depdc1a UTSW 3 159522852 missense possibly damaging 0.74
R7366:Depdc1a UTSW 3 159523212 missense probably benign 0.00
R7531:Depdc1a UTSW 3 159522639 missense probably damaging 1.00
R7886:Depdc1a UTSW 3 159516069 missense probably benign 0.04
R7981:Depdc1a UTSW 3 159520851 missense probably benign 0.00
R8335:Depdc1a UTSW 3 159523222 missense probably damaging 1.00
R8488:Depdc1a UTSW 3 159523875 missense probably damaging 0.96
R8560:Depdc1a UTSW 3 159514275 missense probably damaging 1.00
R8725:Depdc1a UTSW 3 159522719 missense probably benign 0.03
R8727:Depdc1a UTSW 3 159522719 missense probably benign 0.03
X0026:Depdc1a UTSW 3 159498631 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACTCAGATGAAAATGCTCAGCAGC -3'
(R):5'- TGCAGCAAACCTAGAAGGCAAAGTC -3'

Sequencing Primer
(F):5'- CTGCTTTGACTGTTCAAGACCAAG -3'
(R):5'- TGCCATGACCAAAGCATTTTAC -3'
Posted On2014-02-18