Incidental Mutation 'R1317:Gmeb1'
ID157563
Institutional Source Beutler Lab
Gene Symbol Gmeb1
Ensembl Gene ENSMUSG00000028901
Gene Nameglucocorticoid modulatory element binding protein 1
Synonyms1110050A04Rik
MMRRC Submission 039383-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.750) question?
Stock #R1317 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location132221025-132261602 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 132234887 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 154 (Q154*)
Ref Sequence ENSEMBL: ENSMUSP00000131331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030733] [ENSMUST00000105964] [ENSMUST00000105965] [ENSMUST00000168553]
Predicted Effect probably null
Transcript: ENSMUST00000030733
AA Change: Q154*
SMART Domains Protein: ENSMUSP00000030733
Gene: ENSMUSG00000028901
AA Change: Q154*

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
SAND 83 156 8.01e-36 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 311 345 N/A INTRINSIC
low complexity region 364 371 N/A INTRINSIC
low complexity region 457 467 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105964
AA Change: Q154*
SMART Domains Protein: ENSMUSP00000101584
Gene: ENSMUSG00000028901
AA Change: Q154*

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
SAND 83 156 8.01e-36 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 311 345 N/A INTRINSIC
low complexity region 364 371 N/A INTRINSIC
low complexity region 457 467 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105965
AA Change: Q154*
SMART Domains Protein: ENSMUSP00000101585
Gene: ENSMUSG00000028901
AA Change: Q154*

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
SAND 83 156 8.01e-36 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 311 345 N/A INTRINSIC
low complexity region 364 371 N/A INTRINSIC
low complexity region 457 467 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131763
Predicted Effect probably null
Transcript: ENSMUST00000168553
AA Change: Q154*
SMART Domains Protein: ENSMUSP00000131331
Gene: ENSMUSG00000028901
AA Change: Q154*

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
SAND 83 156 8.01e-36 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 311 345 N/A INTRINSIC
low complexity region 364 371 N/A INTRINSIC
low complexity region 457 467 N/A INTRINSIC
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of KDWK gene family which associates with GMEB2 protein. The GMEB1-GMEB2 complex is essential for parvovirus DNA replication. Studies in rat for a similar gene suggest that this gene's role is to modulate the transactivation of the glucocorticoid receptor when it is bound to glucocorticoid response elements. Three alternative spliced transcript variants encoding different isoforms exist. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Afdn A G 17: 13,846,273 T576A probably benign Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Ccdc7b A T 8: 129,136,646 H223L probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cryba2 G T 1: 74,890,676 probably null Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Hnrnpu G A 1: 178,330,257 probably benign Het
Ifi209 A G 1: 173,637,463 D53G possibly damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Jag2 T A 12: 112,914,501 M537L probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mt1 T C 8: 94,180,153 probably benign Het
Myo15b C A 11: 115,883,634 P2024Q probably null Het
Nphs1 C T 7: 30,481,831 probably benign Het
Rbm27 G A 18: 42,324,051 probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Slc25a23 T C 17: 57,053,888 K179E possibly damaging Het
Smad5 T C 13: 56,736,071 probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Trim30b T A 7: 104,357,335 T105S possibly damaging Het
Tspan32 A G 7: 143,017,591 M159V probably benign Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Zbtb1 A G 12: 76,386,799 S520G probably benign Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Other mutations in Gmeb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Gmeb1 APN 4 132227985 missense probably benign 0.00
IGL02089:Gmeb1 APN 4 132225836 missense probably damaging 1.00
R0137:Gmeb1 UTSW 4 132232108 missense probably benign 0.01
R0326:Gmeb1 UTSW 4 132242352 missense probably damaging 0.98
R0611:Gmeb1 UTSW 4 132226075 nonsense probably null
R0898:Gmeb1 UTSW 4 132234782 missense probably benign 0.01
R1453:Gmeb1 UTSW 4 132242448 missense possibly damaging 0.56
R1573:Gmeb1 UTSW 4 132251740 missense probably benign 0.12
R1751:Gmeb1 UTSW 4 132234887 nonsense probably null
R1754:Gmeb1 UTSW 4 132232027 missense probably benign
R1761:Gmeb1 UTSW 4 132234887 nonsense probably null
R5203:Gmeb1 UTSW 4 132232009 splice site probably null
R6241:Gmeb1 UTSW 4 132242377 missense possibly damaging 0.64
R6241:Gmeb1 UTSW 4 132246013 missense probably benign 0.00
R7103:Gmeb1 UTSW 4 132234868 missense probably damaging 0.99
R7192:Gmeb1 UTSW 4 132227890 missense probably benign 0.03
R7401:Gmeb1 UTSW 4 132225774 missense probably damaging 0.97
R7528:Gmeb1 UTSW 4 132232050 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TTCCAGGGTAAGATCCTACCCACG -3'
(R):5'- GGTGAAGAACACTGACACTCCACAG -3'

Sequencing Primer
(F):5'- gggaggcagaagcaagag -3'
(R):5'- CTCCACAGTCTCAGAAGAGTAGTG -3'
Posted On2014-02-18