Mutagenetix > Incidental Mutation

Incidental Mutation 'R1317:Nphs1'

157564

Institutional Source

Beutler Lab

Gene Symbol

Nphs1

Ensembl Gene

ENSMUSG00000006649

Gene Name

nephrosis 1, nephrin

Synonyms

nephrin

MMRRC Submission

039383-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1317 (G1)

Quality Score

198

Status

Validated

Chromosome

Chromosomal Location

30458315-30487223 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 30481831 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]

AlphaFold

Q9QZS7

Predicted Effect

probably benign
Transcript: ENSMUST00000006825

SMART Domains

Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
IG	52	146	1.38e-6	SMART
Pfam:C2-set_2	152	242	4.1e-20	PFAM
IG	264	351	9.86e-3	SMART
IG_like	360	452	2.73e1	SMART
IG	464	556	2.99e-2	SMART
IG_like	572	644	8.9e-1	SMART
IG	667	751	1.32e-3	SMART
IG	760	849	7.3e-6	SMART
IGc2	868	941	5.4e-9	SMART
FN3	955	1036	1.01e-11	SMART
transmembrane domain	1078	1100	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123880

Predicted Effect

probably benign
Transcript: ENSMUST00000126297

SMART Domains

Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649

Domain	Start	End	E-Value	Type
IG	38	132	1.38e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131004

Predicted Effect

probably benign
Transcript: ENSMUST00000149086

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208689

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 93.7%
20x: 84.9%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	C	T	16: 56,668,309	H1268Y	possibly damaging	Het
Afdn	A	G	17: 13,846,273	T576A	probably benign	Het
Bcl6	G	T	16: 23,977,542	A45D	probably damaging	Het
Ccdc7b	A	T	8: 129,136,646	H223L	probably benign	Het
Cdh15	G	C	8: 122,857,495	E112Q	probably damaging	Het
Cryba2	G	T	1: 74,890,676		probably null	Het
Depdc1a	T	C	3: 159,523,287	C559R	probably damaging	Het
Fam20a	A	T	11: 109,677,838	N287K	probably damaging	Het
Gm5519	T	C	19: 33,824,991	Y145H	possibly damaging	Het
Gm9602	T	A	14: 4,776,499	I28N	probably damaging	Het
Gmeb1	G	A	4: 132,234,887	Q154*	probably null	Het
Gpr156	T	C	16: 37,987,567	L192P	probably damaging	Het
Hnrnpu	G	A	1: 178,330,257		probably benign	Het
Ifi209	A	G	1: 173,637,463	D53G	possibly damaging	Het
Irf6	G	A	1: 193,169,301	R400H	probably damaging	Het
Jag2	T	A	12: 112,914,501	M537L	probably benign	Het
Mid1	A	C	X: 169,986,094	N215H	probably damaging	Het
Mt1	T	C	8: 94,180,153		probably benign	Het
Myo15b	C	A	11: 115,883,634	P2024Q	probably null	Het
Rbm27	G	A	18: 42,324,051		probably benign	Het
Robo2	A	G	16: 74,035,024	V256A	probably damaging	Het
Rps24	A	G	14: 24,491,762	T6A	probably damaging	Het
Scg3	G	A	9: 75,669,340	T251M	probably damaging	Het
Slc25a23	T	C	17: 57,053,888	K179E	possibly damaging	Het
Smad5	T	C	13: 56,736,071		probably benign	Het
Tom1	T	C	8: 75,051,551	V87A	probably benign	Het
Trim30b	T	A	7: 104,357,335	T105S	possibly damaging	Het
Tspan32	A	G	7: 143,017,591	M159V	probably benign	Het
Tubb1	A	G	2: 174,456,896	S124G	probably benign	Het
Zbtb1	A	G	12: 76,386,799	S520G	probably benign	Het
Zdhhc7	T	A	8: 120,084,900	H188L	probably benign	Het

Other mutations in Nphs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Nphs1	APN	7	30482551	missense	possibly damaging	0.77
IGL00927:Nphs1	APN	7	30460739	unclassified	probably benign
IGL00976:Nphs1	APN	7	30460685	missense	possibly damaging	0.78
IGL01397:Nphs1	APN	7	30486664	missense	probably benign	0.01
IGL01465:Nphs1	APN	7	30486714	makesense	probably null
IGL01889:Nphs1	APN	7	30460511	missense	probably damaging	1.00
IGL02383:Nphs1	APN	7	30481635	splice site	probably benign
R0020:Nphs1	UTSW	7	30463208	missense	probably benign	0.01
R0485:Nphs1	UTSW	7	30467515	missense	probably benign
R1024:Nphs1	UTSW	7	30474277	missense	probably damaging	1.00
R1115:Nphs1	UTSW	7	30481378	splice site	probably benign
R1144:Nphs1	UTSW	7	30481678	splice site	probably benign
R1289:Nphs1	UTSW	7	30471178	missense	probably damaging	1.00
R1617:Nphs1	UTSW	7	30482531	missense	probably benign
R1756:Nphs1	UTSW	7	30461534	missense	probably benign	0.00
R1937:Nphs1	UTSW	7	30474373	missense	probably damaging	1.00
R2144:Nphs1	UTSW	7	30460970	missense	probably benign	0.13
R2256:Nphs1	UTSW	7	30467992	missense	possibly damaging	0.94
R2257:Nphs1	UTSW	7	30467992	missense	possibly damaging	0.94
R2277:Nphs1	UTSW	7	30467564	nonsense	probably null
R3104:Nphs1	UTSW	7	30467540	nonsense	probably null
R3106:Nphs1	UTSW	7	30467540	nonsense	probably null
R3151:Nphs1	UTSW	7	30460240	missense	probably benign
R3765:Nphs1	UTSW	7	30471210	missense	probably damaging	0.98
R4078:Nphs1	UTSW	7	30467520	nonsense	probably null
R4397:Nphs1	UTSW	7	30481965	splice site	probably null
R4635:Nphs1	UTSW	7	30468007	missense	probably benign	0.39
R4650:Nphs1	UTSW	7	30482470	missense	probably benign	0.21
R4811:Nphs1	UTSW	7	30460429	missense	probably damaging	1.00
R4850:Nphs1	UTSW	7	30463232	missense	possibly damaging	0.78
R5272:Nphs1	UTSW	7	30481642	missense	possibly damaging	0.86
R5327:Nphs1	UTSW	7	30463825	missense	probably benign	0.00
R5681:Nphs1	UTSW	7	30486625	missense	probably benign	0.00
R5865:Nphs1	UTSW	7	30474385	missense	probably damaging	1.00
R5975:Nphs1	UTSW	7	30466115	missense	possibly damaging	0.82
R6186:Nphs1	UTSW	7	30465634	missense	probably damaging	0.98
R6198:Nphs1	UTSW	7	30467915	missense	probably damaging	0.97
R6353:Nphs1	UTSW	7	30474544	missense	probably damaging	0.99
R7405:Nphs1	UTSW	7	30462828	missense	possibly damaging	0.46
R7647:Nphs1	UTSW	7	30481965	splice site	probably null
R7767:Nphs1	UTSW	7	30463308	missense	probably damaging	1.00
R8132:Nphs1	UTSW	7	30482053	missense	probably benign	0.02
R8485:Nphs1	UTSW	7	30466173	missense	probably damaging	0.98
R8678:Nphs1	UTSW	7	30463859	missense	probably damaging	1.00
R8890:Nphs1	UTSW	7	30462655	missense	probably damaging	1.00
R8946:Nphs1	UTSW	7	30463200	missense	probably damaging	1.00
R9133:Nphs1	UTSW	7	30460667	nonsense	probably null
R9159:Nphs1	UTSW	7	30465601	missense	possibly damaging	0.93
R9347:Nphs1	UTSW	7	30471169	missense	probably damaging	1.00
R9547:Nphs1	UTSW	7	30481450	missense	probably benign	0.00
R9548:Nphs1	UTSW	7	30481450	missense	probably benign	0.00
R9607:Nphs1	UTSW	7	30463587	missense	probably damaging	1.00
R9626:Nphs1	UTSW	7	30467566	missense	probably benign	0.16
R9720:Nphs1	UTSW	7	30466074	missense	possibly damaging	0.83
R9733:Nphs1	UTSW	7	30467530	missense	probably damaging	1.00
X0028:Nphs1	UTSW	7	30467504	missense	probably null	0.01
Z1177:Nphs1	UTSW	7	30470903	missense	probably damaging	1.00
Z1186:Nphs1	UTSW	7	30460350	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTGAACAGAGTCTCTGAAGCCC -3'
(R):5'- TGTGCTAACCTGTCTCACACATGC -3'

Sequencing Primer
(F):5'- AGTCTCTGAAGCCCCCTCC -3'
(R):5'- GGTCATTTCCCTTGACTCTCAG -3'

Posted On

2014-02-18