Incidental Mutation 'R1317:Trim30b'
ID157565
Institutional Source Beutler Lab
Gene Symbol Trim30b
Ensembl Gene ENSMUSG00000052749
Gene Nametripartite motif-containing 30B
SynonymsTrim30-1, A530023O14Rik
MMRRC Submission 039383-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1317 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104355382-104369884 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104357335 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 105 (T105S)
Ref Sequence ENSEMBL: ENSMUSP00000131288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059037] [ENSMUST00000106831] [ENSMUST00000130139] [ENSMUST00000164410] [ENSMUST00000171830]
Predicted Effect probably benign
Transcript: ENSMUST00000059037
SMART Domains Protein: ENSMUSP00000060100
Gene: ENSMUSG00000057143

DomainStartEndE-ValueType
RING 15 58 5.51e-7 SMART
BBOX 91 132 4.83e-12 SMART
low complexity region 196 209 N/A INTRINSIC
Pfam:SPRY 351 493 8.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106831
SMART Domains Protein: ENSMUSP00000102444
Gene: ENSMUSG00000052749

DomainStartEndE-ValueType
RING 15 59 4.37e-10 SMART
BBOX 92 133 2.82e-13 SMART
coiled coil region 138 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130139
SMART Domains Protein: ENSMUSP00000116775
Gene: ENSMUSG00000057143

DomainStartEndE-ValueType
RING 15 58 5.51e-7 SMART
BBOX 91 132 4.83e-12 SMART
low complexity region 196 209 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155961
Predicted Effect probably benign
Transcript: ENSMUST00000164410
SMART Domains Protein: ENSMUSP00000131747
Gene: ENSMUSG00000052749

DomainStartEndE-ValueType
RING 15 59 4.37e-10 SMART
BBOX 92 133 2.82e-13 SMART
coiled coil region 138 171 N/A INTRINSIC
low complexity region 190 199 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171830
AA Change: T105S

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131288
Gene: ENSMUSG00000052749
AA Change: T105S

DomainStartEndE-ValueType
PDB:3UV9|A 1 132 5e-9 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209729
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.9%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Afdn A G 17: 13,846,273 T576A probably benign Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Ccdc7b A T 8: 129,136,646 H223L probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cryba2 G T 1: 74,890,676 probably null Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Hnrnpu G A 1: 178,330,257 probably benign Het
Ifi209 A G 1: 173,637,463 D53G possibly damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Jag2 T A 12: 112,914,501 M537L probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mt1 T C 8: 94,180,153 probably benign Het
Myo15b C A 11: 115,883,634 P2024Q probably null Het
Nphs1 C T 7: 30,481,831 probably benign Het
Rbm27 G A 18: 42,324,051 probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Slc25a23 T C 17: 57,053,888 K179E possibly damaging Het
Smad5 T C 13: 56,736,071 probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Tspan32 A G 7: 143,017,591 M159V probably benign Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Zbtb1 A G 12: 76,386,799 S520G probably benign Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Other mutations in Trim30b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:Trim30b APN 7 104366051 nonsense probably null
IGL02262:Trim30b APN 7 104365900 missense probably damaging 0.99
IGL03297:Trim30b APN 7 104365895 missense probably benign 0.40
R0078:Trim30b UTSW 7 104365895 missense probably benign 0.40
R0416:Trim30b UTSW 7 104363766 missense probably benign 0.08
R0511:Trim30b UTSW 7 104365803 missense possibly damaging 0.91
R0555:Trim30b UTSW 7 104357298 missense possibly damaging 0.73
R0609:Trim30b UTSW 7 104357976 start gained probably benign
R1318:Trim30b UTSW 7 104357335 missense possibly damaging 0.90
R1528:Trim30b UTSW 7 104357299 missense possibly damaging 0.73
R1603:Trim30b UTSW 7 104365812 missense possibly damaging 0.70
R3859:Trim30b UTSW 7 104357280 missense probably benign 0.00
R4052:Trim30b UTSW 7 104357478 missense possibly damaging 0.64
R4576:Trim30b UTSW 7 104357331 missense possibly damaging 0.75
R4577:Trim30b UTSW 7 104357331 missense possibly damaging 0.75
R4578:Trim30b UTSW 7 104357331 missense possibly damaging 0.75
R5705:Trim30b UTSW 7 104357577 missense probably damaging 1.00
R5753:Trim30b UTSW 7 104357337 missense possibly damaging 0.89
R5846:Trim30b UTSW 7 104357371 missense possibly damaging 0.94
R5914:Trim30b UTSW 7 104357365 missense probably damaging 0.98
R6083:Trim30b UTSW 7 104366142 missense probably damaging 0.98
R6862:Trim30b UTSW 7 104363753 missense probably damaging 0.98
R7216:Trim30b UTSW 7 104357362 missense probably benign 0.22
R8062:Trim30b UTSW 7 104366186 start gained probably benign
R8516:Trim30b UTSW 7 104357404 missense probably benign 0.00
R8552:Trim30b UTSW 7 104366029 missense probably benign 0.01
R8824:Trim30b UTSW 7 104357906 start gained probably benign
Z1088:Trim30b UTSW 7 104366100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCTACACCAGACATAGGGCAC -3'
(R):5'- CACATGCTGCACCCCAACTTTG -3'

Sequencing Primer
(F):5'- ACGCATACTGTCATTGGCATTG -3'
(R):5'- CTTTGTTCTATGAATGAAATGTTCCC -3'
Posted On2014-02-18