Incidental Mutation 'R1317:Tom1'
ID157567
Institutional Source Beutler Lab
Gene Symbol Tom1
Ensembl Gene ENSMUSG00000042870
Gene Nametarget of myb1 trafficking protein
Synonyms
MMRRC Submission 039383-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1317 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location75033705-75070121 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75051551 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 87 (V87A)
Ref Sequence ENSEMBL: ENSMUSP00000077891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078847] [ENSMUST00000165630] [ENSMUST00000211869] [ENSMUST00000212299] [ENSMUST00000212388] [ENSMUST00000212564] [ENSMUST00000212651]
Predicted Effect probably benign
Transcript: ENSMUST00000078847
AA Change: V87A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000077891
Gene: ENSMUSG00000042870
AA Change: V87A

DomainStartEndE-ValueType
VHS 13 148 4.03e-68 SMART
Pfam:GAT 228 303 1.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165630
AA Change: V87A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000130854
Gene: ENSMUSG00000042870
AA Change: V87A

DomainStartEndE-ValueType
VHS 13 148 4.03e-68 SMART
Pfam:GAT 212 312 5.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211938
Predicted Effect probably benign
Transcript: ENSMUST00000212299
Predicted Effect probably benign
Transcript: ENSMUST00000212388
Predicted Effect probably benign
Transcript: ENSMUST00000212564
AA Change: Y61H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212651
Meta Mutation Damage Score 0.0752 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a target of the v-myb oncogene. The encoded protein shares its N-terminal domain in common with proteins associated with vesicular trafficking at the endosome. It is recruited to the endosomes by its interaction with endofin. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Afdn A G 17: 13,846,273 T576A probably benign Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Ccdc7b A T 8: 129,136,646 H223L probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cryba2 G T 1: 74,890,676 probably null Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Hnrnpu G A 1: 178,330,257 probably benign Het
Ifi209 A G 1: 173,637,463 D53G possibly damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Jag2 T A 12: 112,914,501 M537L probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mt1 T C 8: 94,180,153 probably benign Het
Myo15b C A 11: 115,883,634 P2024Q probably null Het
Nphs1 C T 7: 30,481,831 probably benign Het
Rbm27 G A 18: 42,324,051 probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Slc25a23 T C 17: 57,053,888 K179E possibly damaging Het
Smad5 T C 13: 56,736,071 probably benign Het
Trim30b T A 7: 104,357,335 T105S possibly damaging Het
Tspan32 A G 7: 143,017,591 M159V probably benign Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Zbtb1 A G 12: 76,386,799 S520G probably benign Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Other mutations in Tom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Tom1 APN 8 75052174 missense probably benign 0.27
IGL00979:Tom1 APN 8 75054703 unclassified probably benign
IGL01143:Tom1 APN 8 75058457 missense probably benign 0.00
IGL02825:Tom1 APN 8 75057255 missense probably damaging 1.00
R0335:Tom1 UTSW 8 75064392 critical splice acceptor site probably null
R0762:Tom1 UTSW 8 75052306 splice site probably benign
R1509:Tom1 UTSW 8 75054631 missense probably damaging 1.00
R1691:Tom1 UTSW 8 75051599 missense probably damaging 1.00
R1761:Tom1 UTSW 8 75051551 missense probably benign 0.03
R1906:Tom1 UTSW 8 75051590 missense probably damaging 1.00
R3966:Tom1 UTSW 8 75059239 missense probably benign 0.05
R5004:Tom1 UTSW 8 75052002 missense probably damaging 1.00
R5513:Tom1 UTSW 8 75057220 missense probably damaging 0.99
R5906:Tom1 UTSW 8 75050258 missense probably damaging 1.00
R6147:Tom1 UTSW 8 75054692 missense possibly damaging 0.90
R6964:Tom1 UTSW 8 75051965 missense probably null 1.00
R7010:Tom1 UTSW 8 75051975 missense probably damaging 0.98
R7131:Tom1 UTSW 8 75057249 missense possibly damaging 0.88
R7147:Tom1 UTSW 8 75057267 missense probably damaging 1.00
R8701:Tom1 UTSW 8 75052168 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTAGTAGGAAGGGAGTCTTGTCTGTC -3'
(R):5'- GCAGCTCACTAGCAGAGTAGAATAGCC -3'

Sequencing Primer
(F):5'- GTCTGTCCTGTCATGTCCCAG -3'
(R):5'- GAGTAGAATAGCCCCAGAATTCC -3'
Posted On2014-02-18