Incidental Mutation 'R1317:Mt1'
ID157568
Institutional Source Beutler Lab
Gene Symbol Mt1
Ensembl Gene ENSMUSG00000031765
Gene Namemetallothionein 1
SynonymsMT-I, Mt-1
MMRRC Submission 039383-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1317 (G1)
Quality Score184
Status Validated
Chromosome8
Chromosomal Location94179082-94180327 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 94180153 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034215] [ENSMUST00000211807] [ENSMUST00000212291]
Predicted Effect unknown
Transcript: ENSMUST00000034215
AA Change: V49A
SMART Domains Protein: ENSMUSP00000034215
Gene: ENSMUSG00000031765
AA Change: V49A

DomainStartEndE-ValueType
Pfam:Metallothio 1 61 2.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211807
Predicted Effect unknown
Transcript: ENSMUST00000212291
AA Change: V120A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212456
Meta Mutation Damage Score 0.1380 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.9%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit abnormal zinc absorption and abnormal circadian rhythm response to melatonin. Mice homozygous for null alleles of Mt1 and Mt2 exhibit increased sensitivity to xenobiotics and injury with decreased wound healing and abnormal mineral aborption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Afdn A G 17: 13,846,273 T576A probably benign Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Ccdc7b A T 8: 129,136,646 H223L probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cryba2 G T 1: 74,890,676 probably null Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Hnrnpu G A 1: 178,330,257 probably benign Het
Ifi209 A G 1: 173,637,463 D53G possibly damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Jag2 T A 12: 112,914,501 M537L probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Myo15b C A 11: 115,883,634 P2024Q probably null Het
Nphs1 C T 7: 30,481,831 probably benign Het
Rbm27 G A 18: 42,324,051 probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Slc25a23 T C 17: 57,053,888 K179E possibly damaging Het
Smad5 T C 13: 56,736,071 probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Trim30b T A 7: 104,357,335 T105S possibly damaging Het
Tspan32 A G 7: 143,017,591 M159V probably benign Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Zbtb1 A G 12: 76,386,799 S520G probably benign Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Other mutations in Mt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03060:Mt1 APN 8 94179894 utr 3 prime probably benign
R0635:Mt1 UTSW 8 94179821 critical splice acceptor site probably null
R5357:Mt1 UTSW 8 94180104 missense probably damaging 0.99
R6798:Mt1 UTSW 8 94179888 utr 3 prime probably benign
Z1177:Mt1 UTSW 8 94179333 missense unknown
Z1177:Mt1 UTSW 8 94180129 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGAACTCCTACAAAACTGGCTCTG -3'
(R):5'- GAGGAAGCTTATGGGATAGCTTGGC -3'

Sequencing Primer
(F):5'- ACTGGCTCTGAGAAATGTCC -3'
(R):5'- GATAGCTTGGCTTTACCCAAAGAC -3'
Posted On2014-02-18