Mutagenetix > Incidental Mutation

Incidental Mutation 'R1317:Cdh15'

157570

Institutional Source

Beutler Lab

Gene Symbol

Cdh15

Ensembl Gene

ENSMUSG00000031962

Gene Name

cadherin 15

Synonyms

M cadherin, Mcad, Cdh14

MMRRC Submission

039383-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1317 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122847966-122867397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 122857495 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glutamine at position 112 (E112Q)

Ref Sequence

ENSEMBL: ENSMUSP00000034443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]

AlphaFold

P33146

Predicted Effect

probably damaging
Transcript: ENSMUST00000034443
AA Change: E112Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: E112Q

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	64	149	5.95e-18	SMART
CA	173	257	3.09e-25	SMART
CA	280	373	2.5e-11	SMART
CA	396	480	3.45e-14	SMART
Pfam:Cadherin	486	579	5.2e-9	PFAM
transmembrane domain	603	625	N/A	INTRINSIC
Pfam:Cadherin_C	633	783	6.7e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Meta Mutation Damage Score

0.5702

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 93.7%
20x: 84.9%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	C	T	16: 56,668,309	H1268Y	possibly damaging	Het
Afdn	A	G	17: 13,846,273	T576A	probably benign	Het
Bcl6	G	T	16: 23,977,542	A45D	probably damaging	Het
Ccdc7b	A	T	8: 129,136,646	H223L	probably benign	Het
Cryba2	G	T	1: 74,890,676		probably null	Het
Depdc1a	T	C	3: 159,523,287	C559R	probably damaging	Het
Fam20a	A	T	11: 109,677,838	N287K	probably damaging	Het
Gm5519	T	C	19: 33,824,991	Y145H	possibly damaging	Het
Gm9602	T	A	14: 4,776,499	I28N	probably damaging	Het
Gmeb1	G	A	4: 132,234,887	Q154*	probably null	Het
Gpr156	T	C	16: 37,987,567	L192P	probably damaging	Het
Hnrnpu	G	A	1: 178,330,257		probably benign	Het
Ifi209	A	G	1: 173,637,463	D53G	possibly damaging	Het
Irf6	G	A	1: 193,169,301	R400H	probably damaging	Het
Jag2	T	A	12: 112,914,501	M537L	probably benign	Het
Mid1	A	C	X: 169,986,094	N215H	probably damaging	Het
Mt1	T	C	8: 94,180,153		probably benign	Het
Myo15b	C	A	11: 115,883,634	P2024Q	probably null	Het
Nphs1	C	T	7: 30,481,831		probably benign	Het
Rbm27	G	A	18: 42,324,051		probably benign	Het
Robo2	A	G	16: 74,035,024	V256A	probably damaging	Het
Rps24	A	G	14: 24,491,762	T6A	probably damaging	Het
Scg3	G	A	9: 75,669,340	T251M	probably damaging	Het
Slc25a23	T	C	17: 57,053,888	K179E	possibly damaging	Het
Smad5	T	C	13: 56,736,071		probably benign	Het
Tom1	T	C	8: 75,051,551	V87A	probably benign	Het
Trim30b	T	A	7: 104,357,335	T105S	possibly damaging	Het
Tspan32	A	G	7: 143,017,591	M159V	probably benign	Het
Tubb1	A	G	2: 174,456,896	S124G	probably benign	Het
Zbtb1	A	G	12: 76,386,799	S520G	probably benign	Het
Zdhhc7	T	A	8: 120,084,900	H188L	probably benign	Het

Other mutations in Cdh15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cdh15	APN	8	122865323	intron	probably benign
IGL01958:Cdh15	APN	8	122859350	missense	probably damaging	1.00
IGL02588:Cdh15	APN	8	122856552	nonsense	probably null
IGL02793:Cdh15	APN	8	122860982	missense	probably damaging	1.00
IGL02947:Cdh15	APN	8	122865372	missense	probably benign	0.00
R0310:Cdh15	UTSW	8	122865436	missense	probably damaging	1.00
R0441:Cdh15	UTSW	8	122860966	missense	probably damaging	1.00
R0766:Cdh15	UTSW	8	122861449	intron	probably benign
R0898:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1023:Cdh15	UTSW	8	122865200	missense	probably damaging	0.98
R1054:Cdh15	UTSW	8	122864337	missense	possibly damaging	0.85
R1072:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R1081:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1101:Cdh15	UTSW	8	122860846	missense	possibly damaging	0.93
R1208:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1208:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1209:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1210:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1312:Cdh15	UTSW	8	122861449	intron	probably benign
R1318:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1393:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1428:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1429:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1695:Cdh15	UTSW	8	122862016	missense	probably benign	0.05
R2157:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2170:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2178:Cdh15	UTSW	8	122864976	splice site	probably null
R2252:Cdh15	UTSW	8	122857422	missense	probably damaging	1.00
R2290:Cdh15	UTSW	8	122859317	missense	probably damaging	1.00
R2317:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2330:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2345:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2349:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2353:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2354:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2566:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2567:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2568:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2893:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2894:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2937:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2938:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2990:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2992:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2993:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3029:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3030:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3195:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R3441:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3442:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3608:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3686:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R4119:Cdh15	UTSW	8	122863423	missense	probably damaging	1.00
R4120:Cdh15	UTSW	8	122863423	missense	probably damaging	1.00
R4477:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4478:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4480:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4580:Cdh15	UTSW	8	122865158	missense	probably damaging	0.99
R4583:Cdh15	UTSW	8	122865028	missense	probably damaging	0.98
R4619:Cdh15	UTSW	8	122860873	missense	probably damaging	1.00
R4694:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R4731:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R5076:Cdh15	UTSW	8	122864348	missense	possibly damaging	0.82
R5347:Cdh15	UTSW	8	122862063	missense	probably null	1.00
R5375:Cdh15	UTSW	8	122865100	missense	probably damaging	1.00
R5498:Cdh15	UTSW	8	122865178	missense	possibly damaging	0.79
R5778:Cdh15	UTSW	8	122856587	missense	possibly damaging	0.80
R6320:Cdh15	UTSW	8	122864347	missense	probably benign	0.01
R6570:Cdh15	UTSW	8	122857391	missense	probably damaging	1.00
R6708:Cdh15	UTSW	8	122863555	missense	probably benign	0.32
R7505:Cdh15	UTSW	8	122848492	missense	probably benign	0.01
R7527:Cdh15	UTSW	8	122862126	missense	probably damaging	1.00
R7724:Cdh15	UTSW	8	122866961	missense	probably damaging	1.00
R8093:Cdh15	UTSW	8	122866835	missense	probably damaging	1.00
R8485:Cdh15	UTSW	8	122857366	missense	probably damaging	1.00
R8759:Cdh15	UTSW	8	122860889	missense	probably damaging	1.00
R8910:Cdh15	UTSW	8	122848501	missense	probably benign	0.04
R9017:Cdh15	UTSW	8	122857517	critical splice donor site	probably null
R9453:Cdh15	UTSW	8	122859290	missense	probably damaging	0.99
R9699:Cdh15	UTSW	8	122862030	missense	probably benign	0.00
R9705:Cdh15	UTSW	8	122864285	missense	probably damaging	1.00
Z1176:Cdh15	UTSW	8	122864259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTCTGTTGGGGTGAAACACGAAG -3'
(R):5'- ACAGTGATGCTCTGCTCTCCAAAAG -3'

Sequencing Primer
(F):5'- CACGAAGGTATTGGGGTGC -3'
(R):5'- ACCTATTCGCGGCCTCAAG -3'

Posted On

2014-02-18