Incidental Mutation 'R1317:Fam20a'
ID 157574
Institutional Source Beutler Lab
Gene Symbol Fam20a
Ensembl Gene ENSMUSG00000020614
Gene Name family with sequence similarity 20, member A
Synonyms
MMRRC Submission 039383-MU
Accession Numbers

Ncbi RefSeq: NM_153782.1; MGI:2388266

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1317 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 109669749-109722279 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 109677838 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 287 (N287K)
Ref Sequence ENSEMBL: ENSMUSP00000116687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020938] [ENSMUST00000155559]
AlphaFold Q8CID3
Predicted Effect probably damaging
Transcript: ENSMUST00000020938
AA Change: N287K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020938
Gene: ENSMUSG00000020614
AA Change: N287K

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:Fam20C 306 522 8.9e-101 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146408
Predicted Effect probably damaging
Transcript: ENSMUST00000155559
AA Change: N287K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116687
Gene: ENSMUSG00000020614
AA Change: N287K

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:DUF1193 305 525 3.2e-103 PFAM
Meta Mutation Damage Score 0.6913 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.9%
Validation Efficiency 100% (42/42)
MGI Phenotype Strain: 5432376
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a protein that is likely secreted and may function in hematopoiesis. A mutation at this locus has been associated with amelogenesis imperfecta and gingival hyperplasia syndrome. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal ameloblast morphology, disrupted dental enamel formation in both incisor and molar teeth, abnormal kidney morphology, disseminated calcifications of muscular arteries, and intrapulmonary calcifications. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Afdn A G 17: 13,846,273 T576A probably benign Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Ccdc7b A T 8: 129,136,646 H223L probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cryba2 G T 1: 74,890,676 probably null Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Hnrnpu G A 1: 178,330,257 probably benign Het
Ifi209 A G 1: 173,637,463 D53G possibly damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Jag2 T A 12: 112,914,501 M537L probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mt1 T C 8: 94,180,153 probably benign Het
Myo15b C A 11: 115,883,634 P2024Q probably null Het
Nphs1 C T 7: 30,481,831 probably benign Het
Rbm27 G A 18: 42,324,051 probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Slc25a23 T C 17: 57,053,888 K179E possibly damaging Het
Smad5 T C 13: 56,736,071 probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Trim30b T A 7: 104,357,335 T105S possibly damaging Het
Tspan32 A G 7: 143,017,591 M159V probably benign Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Zbtb1 A G 12: 76,386,799 S520G probably benign Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Other mutations in Fam20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Fam20a APN 11 109677762 splice site probably benign
IGL01296:Fam20a APN 11 109685351 missense possibly damaging 0.93
IGL01319:Fam20a APN 11 109678458 splice site probably benign
IGL01322:Fam20a APN 11 109682912 missense probably damaging 1.00
IGL02086:Fam20a APN 11 109673413 missense probably benign 0.00
IGL02563:Fam20a APN 11 109677794 missense possibly damaging 0.53
IGL02883:Fam20a APN 11 109675127 missense probably damaging 0.99
IGL02893:Fam20a APN 11 109721588 missense probably benign 0.00
Infamy UTSW 11 109673342 missense possibly damaging 0.87
snide UTSW 11 109721375 missense possibly damaging 0.92
ungainly UTSW 11 109682870 nonsense probably null
P0026:Fam20a UTSW 11 109675841 critical splice donor site probably null
R0726:Fam20a UTSW 11 109677194 missense probably damaging 1.00
R1462:Fam20a UTSW 11 109677317 missense probably damaging 1.00
R1462:Fam20a UTSW 11 109677317 missense probably damaging 1.00
R1751:Fam20a UTSW 11 109677838 missense probably damaging 0.99
R1761:Fam20a UTSW 11 109677838 missense probably damaging 0.99
R1889:Fam20a UTSW 11 109673554 missense probably benign 0.30
R1895:Fam20a UTSW 11 109673554 missense probably benign 0.30
R1971:Fam20a UTSW 11 109685411 missense probably damaging 1.00
R2192:Fam20a UTSW 11 109674623 missense probably benign 0.13
R3745:Fam20a UTSW 11 109677790 missense probably benign 0.17
R4684:Fam20a UTSW 11 109721687 missense unknown
R4835:Fam20a UTSW 11 109673563 missense probably benign 0.40
R5045:Fam20a UTSW 11 109677885 missense probably benign 0.38
R5161:Fam20a UTSW 11 109673370 missense probably benign 0.00
R5715:Fam20a UTSW 11 109678431 missense probably damaging 1.00
R5817:Fam20a UTSW 11 109673418 missense possibly damaging 0.81
R5960:Fam20a UTSW 11 109675969 intron probably benign
R6162:Fam20a UTSW 11 109682870 nonsense probably null
R6312:Fam20a UTSW 11 109674630 missense probably damaging 1.00
R7231:Fam20a UTSW 11 109721375 missense possibly damaging 0.92
R7311:Fam20a UTSW 11 109674628 nonsense probably null
R7366:Fam20a UTSW 11 109673342 missense possibly damaging 0.87
R8013:Fam20a UTSW 11 109685506 missense possibly damaging 0.92
R8014:Fam20a UTSW 11 109685506 missense possibly damaging 0.92
R9086:Fam20a UTSW 11 109675928 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTCAGACCACTGTTGGACCTAC -3'
(R):5'- TGCTACCCAGACCTTTGGAGAGAAC -3'

Sequencing Primer
(F):5'- ACCTACCAGTGGGCATGATG -3'
(R):5'- tcctccagtctttgtttgcc -3'
Posted On 2014-02-18