Incidental Mutation 'R1317:Zbtb1'
ID157576
Institutional Source Beutler Lab
Gene Symbol Zbtb1
Ensembl Gene ENSMUSG00000033454
Gene Namezinc finger and BTB domain containing 1
SynonymsC430003J21Rik
MMRRC Submission 039383-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.750) question?
Stock #R1317 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location76370266-76396950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76386799 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 520 (S520G)
Ref Sequence ENSEMBL: ENSMUSP00000041955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042779]
Predicted Effect probably benign
Transcript: ENSMUST00000042779
AA Change: S520G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041955
Gene: ENSMUSG00000033454
AA Change: S520G

DomainStartEndE-ValueType
BTB 24 121 1.01e-16 SMART
ZnF_C2H2 216 242 2.17e1 SMART
low complexity region 359 368 N/A INTRINSIC
ZnF_C2H2 421 443 3.38e1 SMART
ZnF_C2H2 534 554 1.4e1 SMART
ZnF_C2H2 578 600 2.02e-1 SMART
ZnF_C2H2 606 628 6.23e-2 SMART
ZnF_C2H2 634 656 1.62e0 SMART
ZnF_C2H2 662 684 1.08e-1 SMART
ZnF_C2H2 686 709 1.36e-2 SMART
Meta Mutation Damage Score 0.1144 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.9%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit abnormal thymus, B cell, and T cell differentiation, and reduced numbers of T, B, and NK cells in the spleen. [provided by MGI curators]
Allele List at MGI

www.informatics.jax.org/javawi2/servlet/WIFetch

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Afdn A G 17: 13,846,273 T576A probably benign Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Ccdc7b A T 8: 129,136,646 H223L probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cryba2 G T 1: 74,890,676 probably null Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Hnrnpu G A 1: 178,330,257 probably benign Het
Ifi209 A G 1: 173,637,463 D53G possibly damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Jag2 T A 12: 112,914,501 M537L probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mt1 T C 8: 94,180,153 probably benign Het
Myo15b C A 11: 115,883,634 P2024Q probably null Het
Nphs1 C T 7: 30,481,831 probably benign Het
Rbm27 G A 18: 42,324,051 probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Slc25a23 T C 17: 57,053,888 K179E possibly damaging Het
Smad5 T C 13: 56,736,071 probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Trim30b T A 7: 104,357,335 T105S possibly damaging Het
Tspan32 A G 7: 143,017,591 M159V probably benign Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Other mutations in Zbtb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01891:Zbtb1 APN 12 76385661 missense probably damaging 1.00
IGL02097:Zbtb1 APN 12 76386597 missense probably damaging 1.00
IGL02328:Zbtb1 APN 12 76386676 missense possibly damaging 0.75
IGL02496:Zbtb1 APN 12 76385395 missense possibly damaging 0.76
IGL03270:Zbtb1 APN 12 76385515 missense possibly damaging 0.59
Limited UTSW 12 76385827 missense probably damaging 0.99
Old_friend UTSW 12 76385891 missense probably damaging 0.96
scant UTSW 12 76385461 missense probably damaging 1.00
R0893:Zbtb1 UTSW 12 76385339 missense probably damaging 1.00
R1525:Zbtb1 UTSW 12 76386432 missense probably benign
R1761:Zbtb1 UTSW 12 76385821 nonsense probably null
R2920:Zbtb1 UTSW 12 76385845 missense possibly damaging 0.83
R5307:Zbtb1 UTSW 12 76386240 missense probably damaging 1.00
R5718:Zbtb1 UTSW 12 76386924 missense probably benign
R5975:Zbtb1 UTSW 12 76386275 missense possibly damaging 0.88
R6484:Zbtb1 UTSW 12 76385891 missense probably damaging 0.96
R6493:Zbtb1 UTSW 12 76386473 missense probably benign
R6513:Zbtb1 UTSW 12 76385830 missense possibly damaging 0.55
R6904:Zbtb1 UTSW 12 76386211 nonsense probably null
R6948:Zbtb1 UTSW 12 76385827 missense probably damaging 0.99
R8725:Zbtb1 UTSW 12 76385872 missense probably damaging 1.00
X0028:Zbtb1 UTSW 12 76385299 missense probably damaging 1.00
Z1191:Zbtb1 UTSW 12 76385249 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTGGCTTAGAGAACATGAGACCC -3'
(R):5'- TCTTCCATGATGGCACCCTTGAAC -3'

Sequencing Primer
(F):5'- GCTGTGTGGACTCACAATAACTG -3'
(R):5'- GATGGCACCCTTGAACATATCTTG -3'
Posted On2014-02-18