Incidental Mutation 'R1317:Smad5'
ID157578
Institutional Source Beutler Lab
Gene Symbol Smad5
Ensembl Gene ENSMUSG00000021540
Gene NameSMAD family member 5
SynonymsSmad 5, Madh5, MusMLP
MMRRC Submission 039383-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1317 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location56703010-56742377 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 56736071 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069557] [ENSMUST00000109874] [ENSMUST00000109876]
Predicted Effect probably benign
Transcript: ENSMUST00000069557
SMART Domains Protein: ENSMUSP00000065798
Gene: ENSMUSG00000021540

DomainStartEndE-ValueType
DWA 26 135 2.29e-68 SMART
low complexity region 186 214 N/A INTRINSIC
low complexity region 218 236 N/A INTRINSIC
DWB 269 441 1.24e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109874
SMART Domains Protein: ENSMUSP00000105500
Gene: ENSMUSG00000021540

DomainStartEndE-ValueType
DWA 26 135 2.29e-68 SMART
low complexity region 186 214 N/A INTRINSIC
low complexity region 218 236 N/A INTRINSIC
DWB 269 441 1.24e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109876
SMART Domains Protein: ENSMUSP00000105502
Gene: ENSMUSG00000021540

DomainStartEndE-ValueType
DWA 26 135 2.29e-68 SMART
low complexity region 186 214 N/A INTRINSIC
low complexity region 218 236 N/A INTRINSIC
DWB 269 441 1.24e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138677
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the transforming growth factor beta signaling pathway that results in an inhibition of the proliferation of hematopoietic progenitor cells. The encoded protein is activated by bone morphogenetic proteins type 1 receptor kinase, and may be involved in cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit vascular, craniofacial, and neural tube defects, improper turning, edema, and a deficiency of primordial germ cells. Mutants die between embryonic days 10.5 and 11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Afdn A G 17: 13,846,273 T576A probably benign Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Ccdc7b A T 8: 129,136,646 H223L probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cryba2 G T 1: 74,890,676 probably null Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Hnrnpu G A 1: 178,330,257 probably benign Het
Ifi209 A G 1: 173,637,463 D53G possibly damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Jag2 T A 12: 112,914,501 M537L probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mt1 T C 8: 94,180,153 probably benign Het
Myo15b C A 11: 115,883,634 P2024Q probably null Het
Nphs1 C T 7: 30,481,831 probably benign Het
Rbm27 G A 18: 42,324,051 probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Slc25a23 T C 17: 57,053,888 K179E possibly damaging Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Trim30b T A 7: 104,357,335 T105S possibly damaging Het
Tspan32 A G 7: 143,017,591 M159V probably benign Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Zbtb1 A G 12: 76,386,799 S520G probably benign Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Other mutations in Smad5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Smad5 APN 13 56723667 missense probably benign 0.11
IGL01407:Smad5 APN 13 56735817 missense probably benign 0.00
IGL02267:Smad5 APN 13 56735790 splice site probably benign
IGL03014:Smad5 UTSW 13 56735941 missense probably damaging 1.00
R2001:Smad5 UTSW 13 56737374 missense probably damaging 0.99
R5401:Smad5 UTSW 13 56727469 missense probably benign 0.00
R5551:Smad5 UTSW 13 56735841 missense probably damaging 1.00
R5734:Smad5 UTSW 13 56723804 missense probably damaging 1.00
R5796:Smad5 UTSW 13 56723832 missense probably damaging 0.98
R5988:Smad5 UTSW 13 56735985 missense probably damaging 0.99
R7557:Smad5 UTSW 13 56727469 missense probably benign 0.00
R7769:Smad5 UTSW 13 56733042 missense possibly damaging 0.95
R8110:Smad5 UTSW 13 56723888 missense probably damaging 1.00
Z1088:Smad5 UTSW 13 56728628 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATTACTGGAGTTTGCTGTGCATC -3'
(R):5'- GCTGAAACTCACCACTCTGAGTCTC -3'

Sequencing Primer
(F):5'- AGTGTCTTAGTGACAGCAGCATC -3'
(R):5'- CTCAGGCCATGAGAGTGAC -3'
Posted On2014-02-18