Incidental Mutation 'R1317:Rps24'
ID 157579
Institutional Source Beutler Lab
Gene Symbol Rps24
Ensembl Gene ENSMUSG00000025290
Gene Name ribosomal protein S24
Synonyms MRP S24
MMRRC Submission 039383-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.826) question?
Stock # R1317 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 24540746-24547028 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24541830 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 6 (T6A)
Ref Sequence ENSEMBL: ENSMUSP00000152944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000112384] [ENSMUST00000169826] [ENSMUST00000223718] [ENSMUST00000223999] [ENSMUST00000225023] [ENSMUST00000224568]
AlphaFold P62849
Predicted Effect probably benign
Transcript: ENSMUST00000026322
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112384
AA Change: T6A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108003
Gene: ENSMUSG00000025290
AA Change: T6A

DomainStartEndE-ValueType
Pfam:Ribosomal_S24e 23 108 4.4e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169826
AA Change: T6A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125977
Gene: ENSMUSG00000025290
AA Change: T6A

DomainStartEndE-ValueType
Pfam:Ribosomal_S24e 24 102 1.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223939
Predicted Effect probably damaging
Transcript: ENSMUST00000223999
AA Change: T6A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000225023
AA Change: T6A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225117
Predicted Effect probably benign
Transcript: ENSMUST00000224568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224549
Meta Mutation Damage Score 0.2687 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S24E family of ribosomal proteins. It is located in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Mutations in this gene result in Diamond-Blackfan anemia. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,488,672 (GRCm39) H1268Y possibly damaging Het
Afdn A G 17: 14,066,535 (GRCm39) T576A probably benign Het
Bcl6 G T 16: 23,796,292 (GRCm39) A45D probably damaging Het
Ccdc7b A T 8: 129,863,127 (GRCm39) H223L probably benign Het
Cdh15 G C 8: 123,584,234 (GRCm39) E112Q probably damaging Het
Cryba2 G T 1: 74,929,835 (GRCm39) probably null Het
Depdc1a T C 3: 159,228,924 (GRCm39) C559R probably damaging Het
Fam20a A T 11: 109,568,664 (GRCm39) N287K probably damaging Het
Gm5519 T C 19: 33,802,391 (GRCm39) Y145H possibly damaging Het
Gm9602 T A 14: 15,932,645 (GRCm39) I28N probably damaging Het
Gmeb1 G A 4: 131,962,198 (GRCm39) Q154* probably null Het
Gpr156 T C 16: 37,807,929 (GRCm39) L192P probably damaging Het
Hnrnpu G A 1: 178,157,822 (GRCm39) probably benign Het
Ifi209 A G 1: 173,465,029 (GRCm39) D53G possibly damaging Het
Irf6 G A 1: 192,851,609 (GRCm39) R400H probably damaging Het
Jag2 T A 12: 112,878,121 (GRCm39) M537L probably benign Het
Mid1 A C X: 168,769,090 (GRCm39) N215H probably damaging Het
Mt1 T C 8: 94,906,781 (GRCm39) probably benign Het
Myo15b C A 11: 115,774,460 (GRCm39) P2024Q probably null Het
Nphs1 C T 7: 30,181,256 (GRCm39) probably benign Het
Rbm27 G A 18: 42,457,116 (GRCm39) probably benign Het
Robo2 A G 16: 73,831,912 (GRCm39) V256A probably damaging Het
Scg3 G A 9: 75,576,622 (GRCm39) T251M probably damaging Het
Slc25a23 T C 17: 57,360,888 (GRCm39) K179E possibly damaging Het
Smad5 T C 13: 56,883,884 (GRCm39) probably benign Het
Tom1 T C 8: 75,778,179 (GRCm39) V87A probably benign Het
Trim30b T A 7: 104,006,542 (GRCm39) T105S possibly damaging Het
Tspan32 A G 7: 142,571,328 (GRCm39) M159V probably benign Het
Tubb1 A G 2: 174,298,689 (GRCm39) S124G probably benign Het
Zbtb1 A G 12: 76,433,573 (GRCm39) S520G probably benign Het
Zdhhc7 T A 8: 120,811,639 (GRCm39) H188L probably benign Het
Other mutations in Rps24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Rps24 APN 14 24,541,823 (GRCm39) missense probably benign
R1209:Rps24 UTSW 14 24,541,830 (GRCm39) missense probably damaging 1.00
R1363:Rps24 UTSW 14 24,541,830 (GRCm39) missense probably damaging 1.00
R1365:Rps24 UTSW 14 24,541,830 (GRCm39) missense probably damaging 1.00
R1393:Rps24 UTSW 14 24,541,830 (GRCm39) missense probably damaging 1.00
R1427:Rps24 UTSW 14 24,541,830 (GRCm39) missense probably damaging 1.00
R1429:Rps24 UTSW 14 24,541,830 (GRCm39) missense probably damaging 1.00
R1771:Rps24 UTSW 14 24,541,830 (GRCm39) missense probably damaging 1.00
R1776:Rps24 UTSW 14 24,541,830 (GRCm39) missense probably damaging 1.00
R2916:Rps24 UTSW 14 24,542,009 (GRCm39) missense probably benign 0.02
R4837:Rps24 UTSW 14 24,541,855 (GRCm39) missense possibly damaging 0.93
R6146:Rps24 UTSW 14 24,540,803 (GRCm39) start gained probably null
R6249:Rps24 UTSW 14 24,543,530 (GRCm39) missense possibly damaging 0.92
R6386:Rps24 UTSW 14 24,542,116 (GRCm39) missense possibly damaging 0.79
R7316:Rps24 UTSW 14 24,540,757 (GRCm39) unclassified probably benign
R8402:Rps24 UTSW 14 24,540,829 (GRCm39) splice site probably benign
V7732:Rps24 UTSW 14 24,541,830 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTCGCTGAATGCCAGCTAC -3'
(R):5'- CCCAGGATGAAGGACATCAATGACC -3'

Sequencing Primer
(F):5'- TCTCCAAGCACTAGAGGCATTG -3'
(R):5'- TGACCTATAAAGAGGTGTAAGAGTC -3'
Posted On 2014-02-18