Incidental Mutation 'R1317:Bcl6'
ID157580
Institutional Source Beutler Lab
Gene Symbol Bcl6
Ensembl Gene ENSMUSG00000022508
Gene NameB cell leukemia/lymphoma 6
SynonymsBcl5
MMRRC Submission 039383-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R1317 (G1)
Quality Score165
Status Validated
Chromosome16
Chromosomal Location23965052-23988852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23977542 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 45 (A45D)
Ref Sequence ENSEMBL: ENSMUSP00000023151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023151]
Predicted Effect probably damaging
Transcript: ENSMUST00000023151
AA Change: A45D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023151
Gene: ENSMUSG00000022508
AA Change: A45D

DomainStartEndE-ValueType
BTB 32 129 4.86e-28 SMART
low complexity region 406 422 N/A INTRINSIC
low complexity region 458 467 N/A INTRINSIC
ZnF_C2H2 519 542 1.33e-1 SMART
ZnF_C2H2 547 569 1.67e-2 SMART
ZnF_C2H2 575 597 2.79e-4 SMART
ZnF_C2H2 603 625 3.89e-3 SMART
ZnF_C2H2 631 653 8.47e-4 SMART
ZnF_C2H2 659 682 4.11e-2 SMART
Meta Mutation Damage Score 0.9677 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal POZ domain. This protein acts as a sequence-specific repressor of transcription, and has been shown to modulate the transcription of STAT-dependent IL-4 responses of B cells. This protein can interact with a variety of POZ-containing proteins that function as transcription corepressors. This gene is found to be frequently translocated and hypermutated in diffuse large-cell lymphoma (DLCL), and may be involved in the pathogenesis of DLCL. Alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mutants develop myocarditis and pulmonary vasculitis, show impaired germinal center formation in the spleen, and display T helper 2 cell hyperimmune responsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Afdn A G 17: 13,846,273 T576A probably benign Het
Ccdc7b A T 8: 129,136,646 H223L probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cryba2 G T 1: 74,890,676 probably null Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Hnrnpu G A 1: 178,330,257 probably benign Het
Ifi209 A G 1: 173,637,463 D53G possibly damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Jag2 T A 12: 112,914,501 M537L probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mt1 T C 8: 94,180,153 probably benign Het
Myo15b C A 11: 115,883,634 P2024Q probably null Het
Nphs1 C T 7: 30,481,831 probably benign Het
Rbm27 G A 18: 42,324,051 probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Slc25a23 T C 17: 57,053,888 K179E possibly damaging Het
Smad5 T C 13: 56,736,071 probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Trim30b T A 7: 104,357,335 T105S possibly damaging Het
Tspan32 A G 7: 143,017,591 M159V probably benign Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Zbtb1 A G 12: 76,386,799 S520G probably benign Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Other mutations in Bcl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Bcl6 APN 16 23974891 missense probably damaging 1.00
IGL02505:Bcl6 APN 16 23977569 missense probably damaging 1.00
IGL03052:Bcl6 APN 16 23975038 splice site probably benign
IGL03271:Bcl6 APN 16 23970006 missense probably benign 0.00
Adriatic UTSW 16 23968133 missense probably damaging 0.99
Catanzaro UTSW 16 23966226 nonsense probably null
Density UTSW 16 23970048 missense possibly damaging 0.91
nouvelle UTSW 16 23969986 missense possibly damaging 0.92
R0220:Bcl6 UTSW 16 23966219 missense possibly damaging 0.95
R0401:Bcl6 UTSW 16 23972594 missense probably damaging 0.97
R0734:Bcl6 UTSW 16 23968139 missense probably damaging 0.99
R1105:Bcl6 UTSW 16 23966155 missense probably benign
R1134:Bcl6 UTSW 16 23968365 missense probably benign
R1325:Bcl6 UTSW 16 23972347 missense probably benign 0.02
R1393:Bcl6 UTSW 16 23977566 missense probably damaging 0.99
R1761:Bcl6 UTSW 16 23977542 missense probably damaging 1.00
R2170:Bcl6 UTSW 16 23974930 missense probably damaging 1.00
R2220:Bcl6 UTSW 16 23972632 nonsense probably null
R2293:Bcl6 UTSW 16 23977609 missense probably damaging 0.98
R2907:Bcl6 UTSW 16 23968119 missense probably damaging 1.00
R3900:Bcl6 UTSW 16 23977554 missense possibly damaging 0.94
R4681:Bcl6 UTSW 16 23968453 intron probably benign
R5015:Bcl6 UTSW 16 23974850 missense probably damaging 0.98
R5112:Bcl6 UTSW 16 23972746 missense probably benign
R5185:Bcl6 UTSW 16 23972947 missense possibly damaging 0.77
R5371:Bcl6 UTSW 16 23969986 missense possibly damaging 0.92
R5586:Bcl6 UTSW 16 23973176 missense probably benign 0.01
R5659:Bcl6 UTSW 16 23968409 nonsense probably null
R5909:Bcl6 UTSW 16 23972806 missense probably benign
R6384:Bcl6 UTSW 16 23974865 missense probably damaging 1.00
R7036:Bcl6 UTSW 16 23974861 missense probably damaging 1.00
R7097:Bcl6 UTSW 16 23972614 missense possibly damaging 0.94
R7097:Bcl6 UTSW 16 23972902 missense probably damaging 1.00
R7122:Bcl6 UTSW 16 23972902 missense probably damaging 1.00
R7153:Bcl6 UTSW 16 23966226 nonsense probably null
R7154:Bcl6 UTSW 16 23966226 nonsense probably null
R7155:Bcl6 UTSW 16 23966226 nonsense probably null
R7156:Bcl6 UTSW 16 23966226 nonsense probably null
R7163:Bcl6 UTSW 16 23966226 nonsense probably null
R7164:Bcl6 UTSW 16 23966226 nonsense probably null
R7434:Bcl6 UTSW 16 23970048 missense possibly damaging 0.91
R7727:Bcl6 UTSW 16 23971413 critical splice donor site probably null
R7914:Bcl6 UTSW 16 23970011 missense possibly damaging 0.68
R8230:Bcl6 UTSW 16 23972902 missense probably damaging 1.00
R8243:Bcl6 UTSW 16 23968133 missense probably damaging 0.99
R8399:Bcl6 UTSW 16 23972948 missense probably benign 0.39
Z1176:Bcl6 UTSW 16 23969958 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACTGCTGGCCTCAAATGCAC -3'
(R):5'- GTCTGTTCAGGCAAACACAACATGG -3'

Sequencing Primer
(F):5'- GCACCTTGGCTTTGATAGCATAAG -3'
(R):5'- ACAACATGGCCTCCCCG -3'
Posted On2014-02-18