Mutagenetix > Incidental Mutation

Incidental Mutation 'R1317:Abi3bp'

157582

Institutional Source

Beutler Lab

Gene Symbol

Abi3bp

Ensembl Gene

ENSMUSG00000035258

Gene Name

ABI gene family, member 3 (NESH) binding protein

Synonyms

D930038M13Rik, eratin, TARSH, 5033411B22Rik

MMRRC Submission

039383-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R1317 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56477878-56690135 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 56668309 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 1268 (H1268Y)

Ref Sequence

ENSEMBL: ENSMUSP00000156096 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048471] [ENSMUST00000096012] [ENSMUST00000096013] [ENSMUST00000171000] [ENSMUST00000231781] [ENSMUST00000231832] [ENSMUST00000231870]

AlphaFold

A0A338P6S8

Predicted Effect

probably benign
Transcript: ENSMUST00000048471
AA Change: H810Y

PolyPhen 2 Score 0.362 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000036257
Gene: ENSMUSG00000035258
AA Change: H810Y

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
FN3	114	203	3.08e-2	SMART
low complexity region	433	446	N/A	INTRINSIC
low complexity region	516	528	N/A	INTRINSIC
low complexity region	579	591	N/A	INTRINSIC
low complexity region	734	747	N/A	INTRINSIC
low complexity region	751	764	N/A	INTRINSIC
FN3	941	1024	6.29e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000096012
AA Change: H710Y

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000093711
Gene: ENSMUSG00000035258
AA Change: H710Y

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
FN3	114	203	3.08e-2	SMART
low complexity region	433	446	N/A	INTRINSIC
low complexity region	634	647	N/A	INTRINSIC
low complexity region	651	664	N/A	INTRINSIC
FN3	841	924	6.29e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000096013
AA Change: H746Y

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000093712
Gene: ENSMUSG00000035258
AA Change: H746Y

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
FN3	114	203	3.08e-2	SMART
low complexity region	433	446	N/A	INTRINSIC
low complexity region	670	683	N/A	INTRINSIC
low complexity region	687	700	N/A	INTRINSIC
FN3	877	960	6.29e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171000
AA Change: H540Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000128818
Gene: ENSMUSG00000035258
AA Change: H540Y

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
FN3	114	203	3.08e-2	SMART
low complexity region	464	477	N/A	INTRINSIC
low complexity region	481	494	N/A	INTRINSIC
FN3	671	754	6.29e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000231781
AA Change: H1268Y

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000231832
AA Change: H515Y

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)

Predicted Effect

unknown
Transcript: ENSMUST00000231870
AA Change: H730Y

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 93.7%
20x: 84.9%

Validation Efficiency

100% (42/42)

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afdn	A	G	17: 13,846,273	T576A	probably benign	Het
Bcl6	G	T	16: 23,977,542	A45D	probably damaging	Het
Ccdc7b	A	T	8: 129,136,646	H223L	probably benign	Het
Cdh15	G	C	8: 122,857,495	E112Q	probably damaging	Het
Cryba2	G	T	1: 74,890,676		probably null	Het
Depdc1a	T	C	3: 159,523,287	C559R	probably damaging	Het
Fam20a	A	T	11: 109,677,838	N287K	probably damaging	Het
Gm5519	T	C	19: 33,824,991	Y145H	possibly damaging	Het
Gm9602	T	A	14: 4,776,499	I28N	probably damaging	Het
Gmeb1	G	A	4: 132,234,887	Q154*	probably null	Het
Gpr156	T	C	16: 37,987,567	L192P	probably damaging	Het
Hnrnpu	G	A	1: 178,330,257		probably benign	Het
Ifi209	A	G	1: 173,637,463	D53G	possibly damaging	Het
Irf6	G	A	1: 193,169,301	R400H	probably damaging	Het
Jag2	T	A	12: 112,914,501	M537L	probably benign	Het
Mid1	A	C	X: 169,986,094	N215H	probably damaging	Het
Mt1	T	C	8: 94,180,153		probably benign	Het
Myo15b	C	A	11: 115,883,634	P2024Q	probably null	Het
Nphs1	C	T	7: 30,481,831		probably benign	Het
Rbm27	G	A	18: 42,324,051		probably benign	Het
Robo2	A	G	16: 74,035,024	V256A	probably damaging	Het
Rps24	A	G	14: 24,491,762	T6A	probably damaging	Het
Scg3	G	A	9: 75,669,340	T251M	probably damaging	Het
Slc25a23	T	C	17: 57,053,888	K179E	possibly damaging	Het
Smad5	T	C	13: 56,736,071		probably benign	Het
Tom1	T	C	8: 75,051,551	V87A	probably benign	Het
Trim30b	T	A	7: 104,357,335	T105S	possibly damaging	Het
Tspan32	A	G	7: 143,017,591	M159V	probably benign	Het
Tubb1	A	G	2: 174,456,896	S124G	probably benign	Het
Zbtb1	A	G	12: 76,386,799	S520G	probably benign	Het
Zdhhc7	T	A	8: 120,084,900	H188L	probably benign	Het

Other mutations in Abi3bp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Abi3bp	APN	16	56602805	missense	probably null	0.99
IGL01580:Abi3bp	APN	16	56675210	missense	probably damaging	1.00
IGL01633:Abi3bp	APN	16	56677800	missense	probably damaging	1.00
IGL01783:Abi3bp	APN	16	56532969	critical splice donor site	probably null
IGL01866:Abi3bp	APN	16	56671973	missense	probably benign	0.19
IGL02022:Abi3bp	APN	16	56592636	missense	probably damaging	1.00
IGL02086:Abi3bp	APN	16	56642567	splice site	probably benign
IGL02122:Abi3bp	APN	16	56687128	splice site	probably benign
IGL02155:Abi3bp	APN	16	56587964	missense	probably damaging	0.99
IGL02351:Abi3bp	APN	16	56654055	missense	possibly damaging	0.91
IGL02358:Abi3bp	APN	16	56654055	missense	possibly damaging	0.91
IGL02418:Abi3bp	APN	16	56604116	splice site	probably benign
IGL02559:Abi3bp	APN	16	56687070	nonsense	probably null
IGL02617:Abi3bp	APN	16	56574444	nonsense	probably null
IGL02810:Abi3bp	APN	16	56677775	missense	probably damaging	1.00
IGL03057:Abi3bp	APN	16	56668391	missense	possibly damaging	0.95
IGL03174:Abi3bp	APN	16	56614747	missense	possibly damaging	0.64
R0389:Abi3bp	UTSW	16	56671307	missense	possibly damaging	0.79
R0485:Abi3bp	UTSW	16	56604012	splice site	probably null
R0557:Abi3bp	UTSW	16	56668387	missense	probably damaging	0.97
R0616:Abi3bp	UTSW	16	56654070	missense	probably damaging	0.99
R0685:Abi3bp	UTSW	16	56532953	missense	possibly damaging	0.90
R0783:Abi3bp	UTSW	16	56595238	critical splice acceptor site	probably null
R0828:Abi3bp	UTSW	16	56677830	missense	probably damaging	1.00
R0841:Abi3bp	UTSW	16	56668276	missense	possibly damaging	0.95
R1078:Abi3bp	UTSW	16	56654081	critical splice donor site	probably null
R1101:Abi3bp	UTSW	16	56606158	missense	probably damaging	1.00
R1116:Abi3bp	UTSW	16	56686429	splice site	probably benign
R1145:Abi3bp	UTSW	16	56668276	missense	possibly damaging	0.95
R1145:Abi3bp	UTSW	16	56668276	missense	possibly damaging	0.95
R1384:Abi3bp	UTSW	16	56574499	missense	probably damaging	1.00
R1460:Abi3bp	UTSW	16	56562417	missense	probably damaging	0.99
R1730:Abi3bp	UTSW	16	56668279	missense	possibly damaging	0.62
R1761:Abi3bp	UTSW	16	56668309	missense	possibly damaging	0.79
R1830:Abi3bp	UTSW	16	56587985	missense	probably damaging	1.00
R1873:Abi3bp	UTSW	16	56574499	missense	probably damaging	1.00
R1875:Abi3bp	UTSW	16	56574499	missense	probably damaging	1.00
R1996:Abi3bp	UTSW	16	56671357	missense	possibly damaging	0.61
R2018:Abi3bp	UTSW	16	56677796	missense	probably damaging	1.00
R2019:Abi3bp	UTSW	16	56677796	missense	probably damaging	1.00
R2035:Abi3bp	UTSW	16	56660218	missense	probably benign	0.21
R2118:Abi3bp	UTSW	16	56477864	unclassified	probably benign
R2202:Abi3bp	UTSW	16	56613203	missense	probably benign	0.06
R2202:Abi3bp	UTSW	16	56650725	nonsense	probably null
R2203:Abi3bp	UTSW	16	56613203	missense	probably benign	0.06
R3030:Abi3bp	UTSW	16	56657319	missense	possibly damaging	0.79
R3952:Abi3bp	UTSW	16	56604038	missense	possibly damaging	0.88
R4176:Abi3bp	UTSW	16	56652200	missense	probably damaging	0.96
R4296:Abi3bp	UTSW	16	56668310	missense	probably benign	0.05
R4301:Abi3bp	UTSW	16	56556903	missense	probably damaging	1.00
R4354:Abi3bp	UTSW	16	56532951	missense	probably benign	0.05
R4417:Abi3bp	UTSW	16	56654035	missense	probably damaging	1.00
R4716:Abi3bp	UTSW	16	56650725	nonsense	probably null
R4808:Abi3bp	UTSW	16	56594516	missense	probably damaging	0.96
R4814:Abi3bp	UTSW	16	56650753	missense	probably benign	0.06
R5016:Abi3bp	UTSW	16	56671268	missense	probably damaging	0.97
R5290:Abi3bp	UTSW	16	56642475	splice site	probably null
R5891:Abi3bp	UTSW	16	56606133	missense	probably damaging	1.00
R5897:Abi3bp	UTSW	16	56604669	missense	possibly damaging	0.53
R6146:Abi3bp	UTSW	16	56671265	missense	probably damaging	0.99
R6267:Abi3bp	UTSW	16	56594497	missense	probably damaging	0.97
R6905:Abi3bp	UTSW	16	56574517	missense	probably damaging	1.00
R6908:Abi3bp	UTSW	16	56657305	missense	probably benign	0.01
R6917:Abi3bp	UTSW	16	56617321	splice site	probably null
R7071:Abi3bp	UTSW	16	56629140	nonsense	probably null
R7194:Abi3bp	UTSW	16	56562371	missense	probably damaging	0.99
R7476:Abi3bp	UTSW	16	56614746	nonsense	probably null
R7554:Abi3bp	UTSW	16	56618212	splice site	probably null
R7571:Abi3bp	UTSW	16	56630982	splice site	probably null
R7661:Abi3bp	UTSW	16	56632900	splice site	probably null
R7662:Abi3bp	UTSW	16	56617323	splice site	probably null
R7910:Abi3bp	UTSW	16	56677742	nonsense	probably null
R8121:Abi3bp	UTSW	16	56631878	missense	unknown
R8781:Abi3bp	UTSW	16	56606149	missense	probably damaging	0.98
R8790:Abi3bp	UTSW	16	56675074	missense	probably damaging	1.00
R8828:Abi3bp	UTSW	16	56687092	missense	probably damaging	1.00
R9094:Abi3bp	UTSW	16	56636227	missense	probably benign	0.00
R9135:Abi3bp	UTSW	16	56596810	missense	probably benign	0.21
R9282:Abi3bp	UTSW	16	56620504	missense	unknown
R9363:Abi3bp	UTSW	16	56618212	splice site	probably null
R9464:Abi3bp	UTSW	16	56588683	missense	possibly damaging	0.48
R9506:Abi3bp	UTSW	16	56617410	missense	unknown
RF008:Abi3bp	UTSW	16	56627589	intron	probably benign
RF016:Abi3bp	UTSW	16	56627587	frame shift	probably null
RF052:Abi3bp	UTSW	16	56627585	intron	probably benign
RF061:Abi3bp	UTSW	16	56627587	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AGGAACCCTTGTGTGCTTCAACTC -3'
(R):5'- GGCTAACAGCATCCAGTCTTTGTGG -3'

Sequencing Primer
(F):5'- TCTGTTGTATCTCCAGAGGAAAG -3'
(R):5'- GGCCAACACAAGCAAGCATC -3'

Posted On

2014-02-18