Incidental Mutation 'R1317:Gm5519'
ID157587
Institutional Source Beutler Lab
Gene Symbol Gm5519
Ensembl Gene ENSMUSG00000037603
Gene Namepredicted pseudogene 5519
Synonyms
MMRRC Submission 039383-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R1317 (G1)
Quality Score99
Status Validated
Chromosome19
Chromosomal Location33822908-33825071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33824991 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 145 (Y145H)
Ref Sequence ENSEMBL: ENSMUSP00000047171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042061]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042061
AA Change: Y145H

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047171
Gene: ENSMUSG00000037603
AA Change: Y145H

DomainStartEndE-ValueType
Pfam:NUDIX 11 142 3.4e-17 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.9%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Afdn A G 17: 13,846,273 T576A probably benign Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Ccdc7b A T 8: 129,136,646 H223L probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cryba2 G T 1: 74,890,676 probably null Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Hnrnpu G A 1: 178,330,257 probably benign Het
Ifi209 A G 1: 173,637,463 D53G possibly damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Jag2 T A 12: 112,914,501 M537L probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mt1 T C 8: 94,180,153 probably benign Het
Myo15b C A 11: 115,883,634 P2024Q probably null Het
Nphs1 C T 7: 30,481,831 probably benign Het
Rbm27 G A 18: 42,324,051 probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Slc25a23 T C 17: 57,053,888 K179E possibly damaging Het
Smad5 T C 13: 56,736,071 probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Trim30b T A 7: 104,357,335 T105S possibly damaging Het
Tspan32 A G 7: 143,017,591 M159V probably benign Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Zbtb1 A G 12: 76,386,799 S520G probably benign Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Other mutations in Gm5519
AlleleSourceChrCoordTypePredicted EffectPPH Score
Graham UTSW 19 33825071 makesense probably null
R1171:Gm5519 UTSW 19 33822972 missense possibly damaging 0.79
R1751:Gm5519 UTSW 19 33824991 missense possibly damaging 0.77
R2873:Gm5519 UTSW 19 33825010 missense possibly damaging 0.88
R5117:Gm5519 UTSW 19 33825071 makesense probably null
R5256:Gm5519 UTSW 19 33823176 missense probably damaging 1.00
R6355:Gm5519 UTSW 19 33825071 makesense probably null
R7673:Gm5519 UTSW 19 33825028 missense probably benign 0.08
R7674:Gm5519 UTSW 19 33825028 missense probably benign 0.08
R7675:Gm5519 UTSW 19 33825028 missense probably benign 0.08
R8078:Gm5519 UTSW 19 33822957 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CTGCGAACAGTAGACACCTCAGATG -3'
(R):5'- TTCTATGCCACCAGGACAATTCAGC -3'

Sequencing Primer
(F):5'- GAATGCTTTGCTACATGAGACCC -3'
(R):5'- TCTTGAGTTATATCAGGAGACTGC -3'
Posted On2014-02-18