Incidental Mutation 'R1318:Dnah7b'
ID 157589
Institutional Source Beutler Lab
Gene Symbol Dnah7b
Ensembl Gene ENSMUSG00000041144
Gene Name dynein, axonemal, heavy chain 7B
Synonyms Dnahc7b, LOC227058
MMRRC Submission 039384-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.118) question?
Stock # R1318 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 46066315-46373546 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 46099509 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 237 (P237L)
Ref Sequence ENSEMBL: ENSMUSP00000068738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069293]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000069293
AA Change: P237L

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: P237L

DomainStartEndE-ValueType
coiled coil region 760 790 N/A INTRINSIC
Pfam:DHC_N2 800 1209 3.7e-150 PFAM
AAA 1364 1503 3.24e-1 SMART
AAA 2012 2160 5.39e-2 SMART
Pfam:AAA_8 2347 2618 2.4e-75 PFAM
Pfam:MT 2630 2979 2.6e-54 PFAM
Pfam:AAA_9 3001 3226 2.3e-98 PFAM
Pfam:Dynein_heavy 3362 4064 8.4e-288 PFAM
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G T 5: 8,701,621 (GRCm38) V334L probably benign Het
Alms1 T G 6: 85,628,549 (GRCm38) S1925A possibly damaging Het
Cdh15 G C 8: 122,857,495 (GRCm38) E112Q probably damaging Het
Comt G T 16: 18,407,891 (GRCm38) D248E probably damaging Het
Ctnna2 A C 6: 76,882,790 (GRCm38) N874K probably damaging Het
Galnt4 T G 10: 99,109,910 (GRCm38) V499G probably damaging Het
Gh T C 11: 106,301,097 (GRCm38) T96A probably benign Het
Gng8 T C 7: 16,895,236 (GRCm38) V29A probably damaging Het
Hnrnpu G A 1: 178,330,257 (GRCm38) probably benign Het
Igdcc4 T C 9: 65,133,690 (GRCm38) L1001P probably damaging Het
Jph1 A C 1: 16,997,490 (GRCm38) F658V probably damaging Het
Kcnj3 A T 2: 55,437,738 (GRCm38) M180L possibly damaging Het
Ldb2 C T 5: 44,535,037 (GRCm38) probably null Het
Mettl2 C A 11: 105,137,771 (GRCm38) Y316* probably null Het
Mug2 G A 6: 122,077,402 (GRCm38) V1047M probably damaging Het
Mxra8 G T 4: 155,841,499 (GRCm38) C140F probably damaging Het
Mylip T C 13: 45,405,925 (GRCm38) I101T probably benign Het
Oasl2 A G 5: 114,901,381 (GRCm38) N210S probably benign Het
Pclo A G 5: 14,679,314 (GRCm38) probably benign Het
Pla2g16 T A 19: 7,579,226 (GRCm38) probably null Het
Rims2 G A 15: 39,517,826 (GRCm38) R1051H probably damaging Het
Rnf4 C A 5: 34,351,246 (GRCm38) R151S probably damaging Het
Serpina11 A T 12: 103,986,518 (GRCm38) probably benign Het
Trim30b T A 7: 104,357,335 (GRCm38) T105S possibly damaging Het
Ttn T C 2: 76,875,820 (GRCm38) probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 (GRCm38) probably benign Het
Zranb1 C A 7: 132,966,552 (GRCm38) S313* probably null Het
Other mutations in Dnah7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Dnah7b APN 1 46,142,149 (GRCm38) missense probably benign 0.04
IGL00796:Dnah7b APN 1 46,211,337 (GRCm38) missense probably damaging 0.96
IGL00825:Dnah7b APN 1 46,224,651 (GRCm38) missense probably damaging 1.00
IGL00910:Dnah7b APN 1 46,066,729 (GRCm38) unclassified probably benign
IGL00950:Dnah7b APN 1 46,214,322 (GRCm38) missense probably benign 0.07
IGL01142:Dnah7b APN 1 46,195,378 (GRCm38) critical splice donor site probably null
IGL01350:Dnah7b APN 1 46,081,432 (GRCm38) splice site probably benign
IGL01392:Dnah7b APN 1 46,126,788 (GRCm38) missense probably damaging 1.00
IGL01403:Dnah7b APN 1 46,116,300 (GRCm38) splice site probably benign
IGL01460:Dnah7b APN 1 46,139,704 (GRCm38) missense possibly damaging 0.82
IGL01576:Dnah7b APN 1 46,268,653 (GRCm38) missense probably damaging 1.00
IGL01693:Dnah7b APN 1 46,358,147 (GRCm38) missense probably benign 0.29
IGL01838:Dnah7b APN 1 46,358,137 (GRCm38) nonsense probably null
IGL01906:Dnah7b APN 1 46,175,453 (GRCm38) missense probably damaging 1.00
IGL01960:Dnah7b APN 1 46,124,337 (GRCm38) splice site probably benign
IGL01989:Dnah7b APN 1 46,289,534 (GRCm38) missense probably damaging 1.00
IGL02127:Dnah7b APN 1 46,139,875 (GRCm38) missense probably benign
IGL02213:Dnah7b APN 1 46,233,592 (GRCm38) missense probably damaging 0.97
IGL02267:Dnah7b APN 1 46,226,930 (GRCm38) missense probably damaging 1.00
IGL02349:Dnah7b APN 1 46,099,503 (GRCm38) nonsense probably null
IGL02381:Dnah7b APN 1 46,277,120 (GRCm38) missense probably damaging 1.00
IGL02473:Dnah7b APN 1 46,234,193 (GRCm38) missense probably damaging 1.00
IGL02484:Dnah7b APN 1 46,195,318 (GRCm38) missense probably damaging 1.00
IGL02590:Dnah7b APN 1 46,123,777 (GRCm38) missense probably benign 0.02
IGL02655:Dnah7b APN 1 46,116,301 (GRCm38) splice site probably benign
IGL02704:Dnah7b APN 1 46,142,133 (GRCm38) missense probably benign 0.03
IGL02719:Dnah7b APN 1 46,099,608 (GRCm38) splice site probably benign
IGL02745:Dnah7b APN 1 46,195,029 (GRCm38) splice site probably benign
IGL02818:Dnah7b APN 1 46,290,808 (GRCm38) missense probably damaging 1.00
IGL02892:Dnah7b APN 1 46,119,298 (GRCm38) missense possibly damaging 0.79
IGL03285:Dnah7b APN 1 46,182,375 (GRCm38) missense probably benign 0.00
IGL03354:Dnah7b APN 1 46,085,689 (GRCm38) missense probably damaging 1.00
IGL03355:Dnah7b APN 1 46,119,304 (GRCm38) missense probably benign 0.18
BB001:Dnah7b UTSW 1 46,219,430 (GRCm38) missense probably benign 0.04
BB011:Dnah7b UTSW 1 46,219,430 (GRCm38) missense probably benign 0.04
PIT4305001:Dnah7b UTSW 1 46,373,348 (GRCm38) missense probably damaging 1.00
R0116:Dnah7b UTSW 1 46,213,360 (GRCm38) missense possibly damaging 0.94
R0145:Dnah7b UTSW 1 46,223,178 (GRCm38) missense probably damaging 1.00
R0230:Dnah7b UTSW 1 46,219,348 (GRCm38) missense probably damaging 1.00
R0302:Dnah7b UTSW 1 46,123,777 (GRCm38) missense probably benign 0.26
R0313:Dnah7b UTSW 1 46,207,643 (GRCm38) missense probably damaging 1.00
R0317:Dnah7b UTSW 1 46,134,656 (GRCm38) missense probably damaging 1.00
R0347:Dnah7b UTSW 1 46,240,944 (GRCm38) missense probably damaging 1.00
R0352:Dnah7b UTSW 1 46,277,126 (GRCm38) missense probably damaging 0.98
R0363:Dnah7b UTSW 1 46,236,788 (GRCm38) missense probably damaging 0.99
R0379:Dnah7b UTSW 1 46,140,176 (GRCm38) missense probably benign 0.00
R0502:Dnah7b UTSW 1 46,219,544 (GRCm38) missense probably damaging 0.96
R0602:Dnah7b UTSW 1 46,324,842 (GRCm38) missense probably damaging 1.00
R0631:Dnah7b UTSW 1 46,240,992 (GRCm38) missense probably benign 0.02
R0664:Dnah7b UTSW 1 46,324,842 (GRCm38) missense probably damaging 1.00
R0882:Dnah7b UTSW 1 46,340,132 (GRCm38) missense probably benign 0.00
R0931:Dnah7b UTSW 1 46,099,612 (GRCm38) splice site probably benign
R1035:Dnah7b UTSW 1 46,124,448 (GRCm38) missense probably benign
R1147:Dnah7b UTSW 1 46,340,266 (GRCm38) missense probably damaging 0.99
R1147:Dnah7b UTSW 1 46,340,266 (GRCm38) missense probably damaging 0.99
R1166:Dnah7b UTSW 1 46,325,810 (GRCm38) missense probably damaging 1.00
R1219:Dnah7b UTSW 1 46,340,120 (GRCm38) missense probably benign 0.00
R1334:Dnah7b UTSW 1 46,322,335 (GRCm38) missense probably damaging 0.99
R1429:Dnah7b UTSW 1 46,289,656 (GRCm38) missense possibly damaging 0.84
R1440:Dnah7b UTSW 1 46,078,593 (GRCm38) splice site probably benign
R1484:Dnah7b UTSW 1 46,137,543 (GRCm38) missense probably benign 0.00
R1529:Dnah7b UTSW 1 46,177,281 (GRCm38) missense probably damaging 1.00
R1544:Dnah7b UTSW 1 46,066,797 (GRCm38) missense unknown
R1607:Dnah7b UTSW 1 46,290,646 (GRCm38) missense probably damaging 1.00
R1609:Dnah7b UTSW 1 46,352,966 (GRCm38) missense probably damaging 1.00
R1652:Dnah7b UTSW 1 46,175,390 (GRCm38) nonsense probably null
R1681:Dnah7b UTSW 1 46,324,712 (GRCm38) nonsense probably null
R1716:Dnah7b UTSW 1 46,191,783 (GRCm38) missense probably damaging 1.00
R1753:Dnah7b UTSW 1 46,322,335 (GRCm38) missense probably damaging 0.99
R1834:Dnah7b UTSW 1 46,233,759 (GRCm38) missense possibly damaging 0.90
R1838:Dnah7b UTSW 1 46,277,105 (GRCm38) missense probably damaging 1.00
R1838:Dnah7b UTSW 1 46,116,177 (GRCm38) missense probably benign 0.04
R1898:Dnah7b UTSW 1 46,236,714 (GRCm38) missense probably benign 0.02
R1962:Dnah7b UTSW 1 46,242,103 (GRCm38) missense possibly damaging 0.95
R2001:Dnah7b UTSW 1 46,142,087 (GRCm38) missense possibly damaging 0.69
R2049:Dnah7b UTSW 1 46,268,670 (GRCm38) missense probably damaging 1.00
R2076:Dnah7b UTSW 1 46,242,321 (GRCm38) nonsense probably null
R2083:Dnah7b UTSW 1 46,241,067 (GRCm38) missense possibly damaging 0.90
R2140:Dnah7b UTSW 1 46,268,670 (GRCm38) missense probably damaging 1.00
R2141:Dnah7b UTSW 1 46,268,670 (GRCm38) missense probably damaging 1.00
R2142:Dnah7b UTSW 1 46,268,670 (GRCm38) missense probably damaging 1.00
R2165:Dnah7b UTSW 1 46,097,992 (GRCm38) splice site probably benign
R2172:Dnah7b UTSW 1 46,124,512 (GRCm38) missense probably benign 0.12
R2239:Dnah7b UTSW 1 46,201,184 (GRCm38) splice site probably benign
R2247:Dnah7b UTSW 1 46,277,063 (GRCm38) missense probably damaging 1.00
R2267:Dnah7b UTSW 1 46,233,915 (GRCm38) missense probably damaging 1.00
R2405:Dnah7b UTSW 1 46,362,954 (GRCm38) missense probably benign 0.31
R2509:Dnah7b UTSW 1 46,195,287 (GRCm38) missense probably damaging 0.96
R2895:Dnah7b UTSW 1 46,139,741 (GRCm38) missense probably damaging 1.00
R2965:Dnah7b UTSW 1 46,207,572 (GRCm38) missense probably damaging 1.00
R3013:Dnah7b UTSW 1 46,188,687 (GRCm38) critical splice donor site probably null
R3022:Dnah7b UTSW 1 46,182,423 (GRCm38) missense probably damaging 0.99
R3056:Dnah7b UTSW 1 46,268,709 (GRCm38) missense possibly damaging 0.95
R3107:Dnah7b UTSW 1 46,352,873 (GRCm38) missense probably benign 0.00
R3735:Dnah7b UTSW 1 46,299,875 (GRCm38) missense probably benign 0.05
R3898:Dnah7b UTSW 1 46,243,257 (GRCm38) missense probably damaging 1.00
R3944:Dnah7b UTSW 1 46,137,485 (GRCm38) missense probably damaging 1.00
R3983:Dnah7b UTSW 1 46,233,711 (GRCm38) missense possibly damaging 0.88
R4041:Dnah7b UTSW 1 46,081,495 (GRCm38) missense probably benign
R4172:Dnah7b UTSW 1 46,226,946 (GRCm38) missense probably damaging 1.00
R4210:Dnah7b UTSW 1 46,137,418 (GRCm38) missense possibly damaging 0.63
R4306:Dnah7b UTSW 1 46,221,772 (GRCm38) missense probably damaging 0.99
R4391:Dnah7b UTSW 1 46,337,594 (GRCm38) splice site probably null
R4414:Dnah7b UTSW 1 46,126,680 (GRCm38) missense probably benign 0.00
R4495:Dnah7b UTSW 1 46,085,632 (GRCm38) missense probably benign 0.00
R4660:Dnah7b UTSW 1 46,289,536 (GRCm38) missense probably damaging 1.00
R4670:Dnah7b UTSW 1 46,078,524 (GRCm38) missense probably damaging 1.00
R4675:Dnah7b UTSW 1 46,217,157 (GRCm38) missense possibly damaging 0.89
R4685:Dnah7b UTSW 1 46,211,328 (GRCm38) missense probably damaging 1.00
R4727:Dnah7b UTSW 1 46,207,656 (GRCm38) missense probably damaging 1.00
R4735:Dnah7b UTSW 1 46,066,955 (GRCm38) missense unknown
R4780:Dnah7b UTSW 1 46,353,014 (GRCm38) missense probably benign
R4828:Dnah7b UTSW 1 46,128,112 (GRCm38) missense possibly damaging 0.59
R4859:Dnah7b UTSW 1 46,356,602 (GRCm38) missense probably damaging 1.00
R4865:Dnah7b UTSW 1 46,195,074 (GRCm38) missense probably damaging 1.00
R4871:Dnah7b UTSW 1 46,081,444 (GRCm38) missense probably benign 0.21
R4881:Dnah7b UTSW 1 46,201,318 (GRCm38) missense probably damaging 1.00
R4902:Dnah7b UTSW 1 46,290,775 (GRCm38) missense probably benign 0.04
R4960:Dnah7b UTSW 1 46,233,726 (GRCm38) missense probably benign
R5000:Dnah7b UTSW 1 46,099,503 (GRCm38) nonsense probably null
R5005:Dnah7b UTSW 1 46,242,028 (GRCm38) missense probably damaging 0.99
R5026:Dnah7b UTSW 1 46,187,363 (GRCm38) missense probably damaging 0.99
R5080:Dnah7b UTSW 1 46,182,380 (GRCm38) nonsense probably null
R5174:Dnah7b UTSW 1 46,243,349 (GRCm38) missense possibly damaging 0.83
R5178:Dnah7b UTSW 1 46,358,216 (GRCm38) missense possibly damaging 0.50
R5244:Dnah7b UTSW 1 46,233,858 (GRCm38) missense probably damaging 1.00
R5250:Dnah7b UTSW 1 46,373,354 (GRCm38) missense probably damaging 1.00
R5350:Dnah7b UTSW 1 46,233,689 (GRCm38) missense probably benign 0.16
R5380:Dnah7b UTSW 1 46,217,191 (GRCm38) missense probably benign 0.18
R5387:Dnah7b UTSW 1 46,188,659 (GRCm38) missense probably damaging 1.00
R5423:Dnah7b UTSW 1 46,358,271 (GRCm38) missense probably benign 0.01
R5426:Dnah7b UTSW 1 46,242,206 (GRCm38) missense possibly damaging 0.82
R5451:Dnah7b UTSW 1 46,242,019 (GRCm38) missense possibly damaging 0.73
R5459:Dnah7b UTSW 1 46,109,312 (GRCm38) missense probably null
R5479:Dnah7b UTSW 1 46,223,105 (GRCm38) missense probably damaging 1.00
R5583:Dnah7b UTSW 1 46,242,199 (GRCm38) missense probably benign 0.06
R5637:Dnah7b UTSW 1 46,356,514 (GRCm38) missense possibly damaging 0.95
R5641:Dnah7b UTSW 1 46,268,764 (GRCm38) splice site probably null
R5659:Dnah7b UTSW 1 46,352,849 (GRCm38) missense probably damaging 1.00
R5739:Dnah7b UTSW 1 46,233,992 (GRCm38) missense probably damaging 1.00
R5759:Dnah7b UTSW 1 46,277,120 (GRCm38) missense probably damaging 1.00
R5821:Dnah7b UTSW 1 46,142,132 (GRCm38) missense possibly damaging 0.91
R5874:Dnah7b UTSW 1 46,191,725 (GRCm38) missense probably damaging 1.00
R5892:Dnah7b UTSW 1 46,337,593 (GRCm38) critical splice donor site probably null
R5918:Dnah7b UTSW 1 46,221,643 (GRCm38) missense probably benign
R5941:Dnah7b UTSW 1 46,187,290 (GRCm38) missense probably damaging 1.00
R5965:Dnah7b UTSW 1 46,362,987 (GRCm38) missense probably damaging 1.00
R5987:Dnah7b UTSW 1 46,119,398 (GRCm38) splice site probably null
R6041:Dnah7b UTSW 1 46,289,645 (GRCm38) missense probably benign 0.04
R6043:Dnah7b UTSW 1 46,139,789 (GRCm38) missense probably benign
R6049:Dnah7b UTSW 1 46,085,602 (GRCm38) missense probably benign
R6131:Dnah7b UTSW 1 46,253,466 (GRCm38) missense probably damaging 1.00
R6168:Dnah7b UTSW 1 46,290,703 (GRCm38) missense probably damaging 1.00
R6195:Dnah7b UTSW 1 46,204,269 (GRCm38) missense probably damaging 1.00
R6219:Dnah7b UTSW 1 46,233,585 (GRCm38) missense probably benign 0.03
R6226:Dnah7b UTSW 1 46,126,668 (GRCm38) missense probably benign 0.01
R6233:Dnah7b UTSW 1 46,204,269 (GRCm38) missense probably damaging 1.00
R6247:Dnah7b UTSW 1 46,225,888 (GRCm38) missense probably benign
R6273:Dnah7b UTSW 1 46,242,316 (GRCm38) missense possibly damaging 0.94
R6279:Dnah7b UTSW 1 46,325,886 (GRCm38) missense probably damaging 1.00
R6300:Dnah7b UTSW 1 46,325,886 (GRCm38) missense probably damaging 1.00
R6330:Dnah7b UTSW 1 46,340,175 (GRCm38) missense probably damaging 1.00
R6476:Dnah7b UTSW 1 46,242,204 (GRCm38) nonsense probably null
R6494:Dnah7b UTSW 1 46,099,431 (GRCm38) missense probably damaging 1.00
R6762:Dnah7b UTSW 1 46,224,742 (GRCm38) missense probably benign 0.12
R6800:Dnah7b UTSW 1 46,340,217 (GRCm38) missense possibly damaging 0.90
R6838:Dnah7b UTSW 1 46,191,788 (GRCm38) missense probably damaging 1.00
R6937:Dnah7b UTSW 1 46,195,120 (GRCm38) missense probably damaging 1.00
R6940:Dnah7b UTSW 1 46,119,268 (GRCm38) missense probably benign 0.12
R6969:Dnah7b UTSW 1 46,358,238 (GRCm38) missense probably damaging 1.00
R6993:Dnah7b UTSW 1 46,195,139 (GRCm38) critical splice donor site probably null
R7040:Dnah7b UTSW 1 46,236,809 (GRCm38) missense probably benign 0.01
R7117:Dnah7b UTSW 1 46,352,813 (GRCm38) critical splice acceptor site probably null
R7135:Dnah7b UTSW 1 46,139,710 (GRCm38) missense probably damaging 0.99
R7153:Dnah7b UTSW 1 46,126,804 (GRCm38) missense probably benign 0.05
R7189:Dnah7b UTSW 1 46,242,142 (GRCm38) missense probably damaging 1.00
R7237:Dnah7b UTSW 1 46,139,966 (GRCm38) missense probably damaging 0.98
R7243:Dnah7b UTSW 1 46,083,754 (GRCm38) missense probably benign
R7244:Dnah7b UTSW 1 46,277,143 (GRCm38) missense probably damaging 0.99
R7248:Dnah7b UTSW 1 46,142,085 (GRCm38) missense possibly damaging 0.83
R7318:Dnah7b UTSW 1 46,195,372 (GRCm38) missense probably damaging 1.00
R7375:Dnah7b UTSW 1 46,303,634 (GRCm38) missense probably damaging 1.00
R7483:Dnah7b UTSW 1 46,175,419 (GRCm38) missense probably damaging 1.00
R7486:Dnah7b UTSW 1 46,290,734 (GRCm38) missense probably damaging 1.00
R7498:Dnah7b UTSW 1 46,325,765 (GRCm38) missense probably damaging 1.00
R7501:Dnah7b UTSW 1 46,356,554 (GRCm38) missense probably damaging 1.00
R7513:Dnah7b UTSW 1 46,124,346 (GRCm38) missense probably benign 0.06
R7547:Dnah7b UTSW 1 46,214,413 (GRCm38) missense possibly damaging 0.82
R7620:Dnah7b UTSW 1 46,268,634 (GRCm38) missense probably damaging 1.00
R7670:Dnah7b UTSW 1 46,109,302 (GRCm38) missense probably benign
R7676:Dnah7b UTSW 1 46,234,164 (GRCm38) nonsense probably null
R7731:Dnah7b UTSW 1 46,139,745 (GRCm38) missense probably benign 0.00
R7760:Dnah7b UTSW 1 46,201,253 (GRCm38) missense probably damaging 1.00
R7768:Dnah7b UTSW 1 46,137,474 (GRCm38) missense probably benign
R7807:Dnah7b UTSW 1 46,214,367 (GRCm38) missense probably benign
R7895:Dnah7b UTSW 1 46,249,950 (GRCm38) missense probably damaging 1.00
R7911:Dnah7b UTSW 1 46,139,678 (GRCm38) missense probably damaging 1.00
R7924:Dnah7b UTSW 1 46,219,430 (GRCm38) missense probably benign 0.04
R7944:Dnah7b UTSW 1 46,227,003 (GRCm38) missense probably benign
R7946:Dnah7b UTSW 1 46,233,579 (GRCm38) missense probably damaging 1.00
R7983:Dnah7b UTSW 1 46,243,424 (GRCm38) missense probably damaging 1.00
R8012:Dnah7b UTSW 1 46,243,365 (GRCm38) missense probably damaging 1.00
R8069:Dnah7b UTSW 1 46,224,706 (GRCm38) nonsense probably null
R8094:Dnah7b UTSW 1 46,126,804 (GRCm38) missense probably benign 0.01
R8137:Dnah7b UTSW 1 46,233,753 (GRCm38) missense probably damaging 1.00
R8167:Dnah7b UTSW 1 46,253,511 (GRCm38) missense possibly damaging 0.95
R8268:Dnah7b UTSW 1 46,356,576 (GRCm38) missense probably benign 0.43
R8309:Dnah7b UTSW 1 46,139,872 (GRCm38) missense probably damaging 1.00
R8313:Dnah7b UTSW 1 46,175,296 (GRCm38) missense possibly damaging 0.81
R8410:Dnah7b UTSW 1 46,356,659 (GRCm38) critical splice donor site probably null
R8438:Dnah7b UTSW 1 46,188,679 (GRCm38) missense probably damaging 1.00
R8446:Dnah7b UTSW 1 46,290,715 (GRCm38) missense probably damaging 1.00
R8471:Dnah7b UTSW 1 46,099,490 (GRCm38) missense possibly damaging 0.92
R8551:Dnah7b UTSW 1 46,116,200 (GRCm38) missense possibly damaging 0.94
R8711:Dnah7b UTSW 1 46,175,438 (GRCm38) missense probably damaging 1.00
R8745:Dnah7b UTSW 1 46,182,464 (GRCm38) missense possibly damaging 0.82
R8765:Dnah7b UTSW 1 46,352,999 (GRCm38) missense possibly damaging 0.91
R8797:Dnah7b UTSW 1 46,123,646 (GRCm38) missense probably damaging 1.00
R8805:Dnah7b UTSW 1 46,234,145 (GRCm38) missense possibly damaging 0.90
R8830:Dnah7b UTSW 1 46,191,793 (GRCm38) missense probably damaging 1.00
R8861:Dnah7b UTSW 1 46,241,076 (GRCm38) missense possibly damaging 0.82
R8905:Dnah7b UTSW 1 46,253,374 (GRCm38) missense probably damaging 0.99
R9009:Dnah7b UTSW 1 46,223,072 (GRCm38) missense probably benign 0.00
R9058:Dnah7b UTSW 1 46,243,415 (GRCm38) missense probably damaging 1.00
R9130:Dnah7b UTSW 1 46,134,514 (GRCm38) missense probably benign 0.01
R9131:Dnah7b UTSW 1 46,227,020 (GRCm38) missense probably damaging 1.00
R9181:Dnah7b UTSW 1 46,142,034 (GRCm38) missense probably damaging 1.00
R9182:Dnah7b UTSW 1 46,290,878 (GRCm38) missense probably benign 0.06
R9223:Dnah7b UTSW 1 46,322,260 (GRCm38) missense probably benign 0.12
R9391:Dnah7b UTSW 1 46,233,754 (GRCm38) nonsense probably null
R9392:Dnah7b UTSW 1 46,123,738 (GRCm38) nonsense probably null
R9456:Dnah7b UTSW 1 46,126,793 (GRCm38) missense possibly damaging 0.82
R9498:Dnah7b UTSW 1 46,214,404 (GRCm38) missense probably benign 0.27
R9553:Dnah7b UTSW 1 46,225,796 (GRCm38) missense probably damaging 0.99
R9598:Dnah7b UTSW 1 46,253,461 (GRCm38) missense possibly damaging 0.67
R9653:Dnah7b UTSW 1 46,213,384 (GRCm38) missense possibly damaging 0.55
R9781:Dnah7b UTSW 1 46,337,594 (GRCm38) splice site probably null
RF020:Dnah7b UTSW 1 46,373,261 (GRCm38) missense possibly damaging 0.84
V8831:Dnah7b UTSW 1 46,373,298 (GRCm38) nonsense probably null
X0023:Dnah7b UTSW 1 46,303,577 (GRCm38) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CATCAACCTGCAATTGAGCATGTACTC -3'
(R):5'- GCAAAATCAGCCAAGGGAATGTGTC -3'

Sequencing Primer
(F):5'- CTTTGGCTTCCAGGAAATAGC -3'
(R):5'- CCAAGGGAATGTGTCAAAATTAGGTG -3'
Posted On 2014-02-18