Mutagenetix > Incidental Mutation

Incidental Mutation 'R1318:Dnah7b'

157589

Institutional Source

Beutler Lab

Gene Symbol

Dnah7b

Ensembl Gene

ENSMUSG00000041144

Gene Name

dynein, axonemal, heavy chain 7B

Synonyms

Dnahc7b, LOC227058

MMRRC Submission

039384-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R1318 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46066315-46373546 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 46099509 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 237 (P237L)

Ref Sequence

ENSEMBL: ENSMUSP00000068738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069293]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069293
AA Change: P237L

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: P237L

Domain	Start	End	E-Value	Type
coiled coil region	760	790	N/A	INTRINSIC
Pfam:DHC_N2	800	1209	3.7e-150	PFAM
AAA	1364	1503	3.24e-1	SMART
AAA	2012	2160	5.39e-2	SMART
Pfam:AAA_8	2347	2618	2.4e-75	PFAM
Pfam:MT	2630	2979	2.6e-54	PFAM
Pfam:AAA_9	3001	3226	2.3e-98	PFAM
Pfam:Dynein_heavy	3362	4064	8.4e-288	PFAM

Coding Region Coverage

1x: 98.6%
3x: 97.3%
10x: 92.9%
20x: 82.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	G	T	5: 8,701,621 (GRCm38)	V334L	probably benign	Het
Alms1	T	G	6: 85,628,549 (GRCm38)	S1925A	possibly damaging	Het
Cdh15	G	C	8: 122,857,495 (GRCm38)	E112Q	probably damaging	Het
Comt	G	T	16: 18,407,891 (GRCm38)	D248E	probably damaging	Het
Ctnna2	A	C	6: 76,882,790 (GRCm38)	N874K	probably damaging	Het
Galnt4	T	G	10: 99,109,910 (GRCm38)	V499G	probably damaging	Het
Gh	T	C	11: 106,301,097 (GRCm38)	T96A	probably benign	Het
Gng8	T	C	7: 16,895,236 (GRCm38)	V29A	probably damaging	Het
Hnrnpu	G	A	1: 178,330,257 (GRCm38)		probably benign	Het
Igdcc4	T	C	9: 65,133,690 (GRCm38)	L1001P	probably damaging	Het
Jph1	A	C	1: 16,997,490 (GRCm38)	F658V	probably damaging	Het
Kcnj3	A	T	2: 55,437,738 (GRCm38)	M180L	possibly damaging	Het
Ldb2	C	T	5: 44,535,037 (GRCm38)		probably null	Het
Mettl2	C	A	11: 105,137,771 (GRCm38)	Y316*	probably null	Het
Mug2	G	A	6: 122,077,402 (GRCm38)	V1047M	probably damaging	Het
Mxra8	G	T	4: 155,841,499 (GRCm38)	C140F	probably damaging	Het
Mylip	T	C	13: 45,405,925 (GRCm38)	I101T	probably benign	Het
Oasl2	A	G	5: 114,901,381 (GRCm38)	N210S	probably benign	Het
Pclo	A	G	5: 14,679,314 (GRCm38)		probably benign	Het
Pla2g16	T	A	19: 7,579,226 (GRCm38)		probably null	Het
Rims2	G	A	15: 39,517,826 (GRCm38)	R1051H	probably damaging	Het
Rnf4	C	A	5: 34,351,246 (GRCm38)	R151S	probably damaging	Het
Serpina11	A	T	12: 103,986,518 (GRCm38)		probably benign	Het
Trim30b	T	A	7: 104,357,335 (GRCm38)	T105S	possibly damaging	Het
Ttn	T	C	2: 76,875,820 (GRCm38)		probably benign	Het
Vmn2r115	ATCTTCT	ATCT	17: 23,359,988 (GRCm38)		probably benign	Het
Zranb1	C	A	7: 132,966,552 (GRCm38)	S313*	probably null	Het

Other mutations in Dnah7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Dnah7b	APN	1	46,142,149 (GRCm38)	missense	probably benign	0.04
IGL00796:Dnah7b	APN	1	46,211,337 (GRCm38)	missense	probably damaging	0.96
IGL00825:Dnah7b	APN	1	46,224,651 (GRCm38)	missense	probably damaging	1.00
IGL00910:Dnah7b	APN	1	46,066,729 (GRCm38)	unclassified	probably benign
IGL00950:Dnah7b	APN	1	46,214,322 (GRCm38)	missense	probably benign	0.07
IGL01142:Dnah7b	APN	1	46,195,378 (GRCm38)	critical splice donor site	probably null
IGL01350:Dnah7b	APN	1	46,081,432 (GRCm38)	splice site	probably benign
IGL01392:Dnah7b	APN	1	46,126,788 (GRCm38)	missense	probably damaging	1.00
IGL01403:Dnah7b	APN	1	46,116,300 (GRCm38)	splice site	probably benign
IGL01460:Dnah7b	APN	1	46,139,704 (GRCm38)	missense	possibly damaging	0.82
IGL01576:Dnah7b	APN	1	46,268,653 (GRCm38)	missense	probably damaging	1.00
IGL01693:Dnah7b	APN	1	46,358,147 (GRCm38)	missense	probably benign	0.29
IGL01838:Dnah7b	APN	1	46,358,137 (GRCm38)	nonsense	probably null
IGL01906:Dnah7b	APN	1	46,175,453 (GRCm38)	missense	probably damaging	1.00
IGL01960:Dnah7b	APN	1	46,124,337 (GRCm38)	splice site	probably benign
IGL01989:Dnah7b	APN	1	46,289,534 (GRCm38)	missense	probably damaging	1.00
IGL02127:Dnah7b	APN	1	46,139,875 (GRCm38)	missense	probably benign
IGL02213:Dnah7b	APN	1	46,233,592 (GRCm38)	missense	probably damaging	0.97
IGL02267:Dnah7b	APN	1	46,226,930 (GRCm38)	missense	probably damaging	1.00
IGL02349:Dnah7b	APN	1	46,099,503 (GRCm38)	nonsense	probably null
IGL02381:Dnah7b	APN	1	46,277,120 (GRCm38)	missense	probably damaging	1.00
IGL02473:Dnah7b	APN	1	46,234,193 (GRCm38)	missense	probably damaging	1.00
IGL02484:Dnah7b	APN	1	46,195,318 (GRCm38)	missense	probably damaging	1.00
IGL02590:Dnah7b	APN	1	46,123,777 (GRCm38)	missense	probably benign	0.02
IGL02655:Dnah7b	APN	1	46,116,301 (GRCm38)	splice site	probably benign
IGL02704:Dnah7b	APN	1	46,142,133 (GRCm38)	missense	probably benign	0.03
IGL02719:Dnah7b	APN	1	46,099,608 (GRCm38)	splice site	probably benign
IGL02745:Dnah7b	APN	1	46,195,029 (GRCm38)	splice site	probably benign
IGL02818:Dnah7b	APN	1	46,290,808 (GRCm38)	missense	probably damaging	1.00
IGL02892:Dnah7b	APN	1	46,119,298 (GRCm38)	missense	possibly damaging	0.79
IGL03285:Dnah7b	APN	1	46,182,375 (GRCm38)	missense	probably benign	0.00
IGL03354:Dnah7b	APN	1	46,085,689 (GRCm38)	missense	probably damaging	1.00
IGL03355:Dnah7b	APN	1	46,119,304 (GRCm38)	missense	probably benign	0.18
BB001:Dnah7b	UTSW	1	46,219,430 (GRCm38)	missense	probably benign	0.04
BB011:Dnah7b	UTSW	1	46,219,430 (GRCm38)	missense	probably benign	0.04
PIT4305001:Dnah7b	UTSW	1	46,373,348 (GRCm38)	missense	probably damaging	1.00
R0116:Dnah7b	UTSW	1	46,213,360 (GRCm38)	missense	possibly damaging	0.94
R0145:Dnah7b	UTSW	1	46,223,178 (GRCm38)	missense	probably damaging	1.00
R0230:Dnah7b	UTSW	1	46,219,348 (GRCm38)	missense	probably damaging	1.00
R0302:Dnah7b	UTSW	1	46,123,777 (GRCm38)	missense	probably benign	0.26
R0313:Dnah7b	UTSW	1	46,207,643 (GRCm38)	missense	probably damaging	1.00
R0317:Dnah7b	UTSW	1	46,134,656 (GRCm38)	missense	probably damaging	1.00
R0347:Dnah7b	UTSW	1	46,240,944 (GRCm38)	missense	probably damaging	1.00
R0352:Dnah7b	UTSW	1	46,277,126 (GRCm38)	missense	probably damaging	0.98
R0363:Dnah7b	UTSW	1	46,236,788 (GRCm38)	missense	probably damaging	0.99
R0379:Dnah7b	UTSW	1	46,140,176 (GRCm38)	missense	probably benign	0.00
R0502:Dnah7b	UTSW	1	46,219,544 (GRCm38)	missense	probably damaging	0.96
R0602:Dnah7b	UTSW	1	46,324,842 (GRCm38)	missense	probably damaging	1.00
R0631:Dnah7b	UTSW	1	46,240,992 (GRCm38)	missense	probably benign	0.02
R0664:Dnah7b	UTSW	1	46,324,842 (GRCm38)	missense	probably damaging	1.00
R0882:Dnah7b	UTSW	1	46,340,132 (GRCm38)	missense	probably benign	0.00
R0931:Dnah7b	UTSW	1	46,099,612 (GRCm38)	splice site	probably benign
R1035:Dnah7b	UTSW	1	46,124,448 (GRCm38)	missense	probably benign
R1147:Dnah7b	UTSW	1	46,340,266 (GRCm38)	missense	probably damaging	0.99
R1147:Dnah7b	UTSW	1	46,340,266 (GRCm38)	missense	probably damaging	0.99
R1166:Dnah7b	UTSW	1	46,325,810 (GRCm38)	missense	probably damaging	1.00
R1219:Dnah7b	UTSW	1	46,340,120 (GRCm38)	missense	probably benign	0.00
R1334:Dnah7b	UTSW	1	46,322,335 (GRCm38)	missense	probably damaging	0.99
R1429:Dnah7b	UTSW	1	46,289,656 (GRCm38)	missense	possibly damaging	0.84
R1440:Dnah7b	UTSW	1	46,078,593 (GRCm38)	splice site	probably benign
R1484:Dnah7b	UTSW	1	46,137,543 (GRCm38)	missense	probably benign	0.00
R1529:Dnah7b	UTSW	1	46,177,281 (GRCm38)	missense	probably damaging	1.00
R1544:Dnah7b	UTSW	1	46,066,797 (GRCm38)	missense	unknown
R1607:Dnah7b	UTSW	1	46,290,646 (GRCm38)	missense	probably damaging	1.00
R1609:Dnah7b	UTSW	1	46,352,966 (GRCm38)	missense	probably damaging	1.00
R1652:Dnah7b	UTSW	1	46,175,390 (GRCm38)	nonsense	probably null
R1681:Dnah7b	UTSW	1	46,324,712 (GRCm38)	nonsense	probably null
R1716:Dnah7b	UTSW	1	46,191,783 (GRCm38)	missense	probably damaging	1.00
R1753:Dnah7b	UTSW	1	46,322,335 (GRCm38)	missense	probably damaging	0.99
R1834:Dnah7b	UTSW	1	46,233,759 (GRCm38)	missense	possibly damaging	0.90
R1838:Dnah7b	UTSW	1	46,277,105 (GRCm38)	missense	probably damaging	1.00
R1838:Dnah7b	UTSW	1	46,116,177 (GRCm38)	missense	probably benign	0.04
R1898:Dnah7b	UTSW	1	46,236,714 (GRCm38)	missense	probably benign	0.02
R1962:Dnah7b	UTSW	1	46,242,103 (GRCm38)	missense	possibly damaging	0.95
R2001:Dnah7b	UTSW	1	46,142,087 (GRCm38)	missense	possibly damaging	0.69
R2049:Dnah7b	UTSW	1	46,268,670 (GRCm38)	missense	probably damaging	1.00
R2076:Dnah7b	UTSW	1	46,242,321 (GRCm38)	nonsense	probably null
R2083:Dnah7b	UTSW	1	46,241,067 (GRCm38)	missense	possibly damaging	0.90
R2140:Dnah7b	UTSW	1	46,268,670 (GRCm38)	missense	probably damaging	1.00
R2141:Dnah7b	UTSW	1	46,268,670 (GRCm38)	missense	probably damaging	1.00
R2142:Dnah7b	UTSW	1	46,268,670 (GRCm38)	missense	probably damaging	1.00
R2165:Dnah7b	UTSW	1	46,097,992 (GRCm38)	splice site	probably benign
R2172:Dnah7b	UTSW	1	46,124,512 (GRCm38)	missense	probably benign	0.12
R2239:Dnah7b	UTSW	1	46,201,184 (GRCm38)	splice site	probably benign
R2247:Dnah7b	UTSW	1	46,277,063 (GRCm38)	missense	probably damaging	1.00
R2267:Dnah7b	UTSW	1	46,233,915 (GRCm38)	missense	probably damaging	1.00
R2405:Dnah7b	UTSW	1	46,362,954 (GRCm38)	missense	probably benign	0.31
R2509:Dnah7b	UTSW	1	46,195,287 (GRCm38)	missense	probably damaging	0.96
R2895:Dnah7b	UTSW	1	46,139,741 (GRCm38)	missense	probably damaging	1.00
R2965:Dnah7b	UTSW	1	46,207,572 (GRCm38)	missense	probably damaging	1.00
R3013:Dnah7b	UTSW	1	46,188,687 (GRCm38)	critical splice donor site	probably null
R3022:Dnah7b	UTSW	1	46,182,423 (GRCm38)	missense	probably damaging	0.99
R3056:Dnah7b	UTSW	1	46,268,709 (GRCm38)	missense	possibly damaging	0.95
R3107:Dnah7b	UTSW	1	46,352,873 (GRCm38)	missense	probably benign	0.00
R3735:Dnah7b	UTSW	1	46,299,875 (GRCm38)	missense	probably benign	0.05
R3898:Dnah7b	UTSW	1	46,243,257 (GRCm38)	missense	probably damaging	1.00
R3944:Dnah7b	UTSW	1	46,137,485 (GRCm38)	missense	probably damaging	1.00
R3983:Dnah7b	UTSW	1	46,233,711 (GRCm38)	missense	possibly damaging	0.88
R4041:Dnah7b	UTSW	1	46,081,495 (GRCm38)	missense	probably benign
R4172:Dnah7b	UTSW	1	46,226,946 (GRCm38)	missense	probably damaging	1.00
R4210:Dnah7b	UTSW	1	46,137,418 (GRCm38)	missense	possibly damaging	0.63
R4306:Dnah7b	UTSW	1	46,221,772 (GRCm38)	missense	probably damaging	0.99
R4391:Dnah7b	UTSW	1	46,337,594 (GRCm38)	splice site	probably null
R4414:Dnah7b	UTSW	1	46,126,680 (GRCm38)	missense	probably benign	0.00
R4495:Dnah7b	UTSW	1	46,085,632 (GRCm38)	missense	probably benign	0.00
R4660:Dnah7b	UTSW	1	46,289,536 (GRCm38)	missense	probably damaging	1.00
R4670:Dnah7b	UTSW	1	46,078,524 (GRCm38)	missense	probably damaging	1.00
R4675:Dnah7b	UTSW	1	46,217,157 (GRCm38)	missense	possibly damaging	0.89
R4685:Dnah7b	UTSW	1	46,211,328 (GRCm38)	missense	probably damaging	1.00
R4727:Dnah7b	UTSW	1	46,207,656 (GRCm38)	missense	probably damaging	1.00
R4735:Dnah7b	UTSW	1	46,066,955 (GRCm38)	missense	unknown
R4780:Dnah7b	UTSW	1	46,353,014 (GRCm38)	missense	probably benign
R4828:Dnah7b	UTSW	1	46,128,112 (GRCm38)	missense	possibly damaging	0.59
R4859:Dnah7b	UTSW	1	46,356,602 (GRCm38)	missense	probably damaging	1.00
R4865:Dnah7b	UTSW	1	46,195,074 (GRCm38)	missense	probably damaging	1.00
R4871:Dnah7b	UTSW	1	46,081,444 (GRCm38)	missense	probably benign	0.21
R4881:Dnah7b	UTSW	1	46,201,318 (GRCm38)	missense	probably damaging	1.00
R4902:Dnah7b	UTSW	1	46,290,775 (GRCm38)	missense	probably benign	0.04
R4960:Dnah7b	UTSW	1	46,233,726 (GRCm38)	missense	probably benign
R5000:Dnah7b	UTSW	1	46,099,503 (GRCm38)	nonsense	probably null
R5005:Dnah7b	UTSW	1	46,242,028 (GRCm38)	missense	probably damaging	0.99
R5026:Dnah7b	UTSW	1	46,187,363 (GRCm38)	missense	probably damaging	0.99
R5080:Dnah7b	UTSW	1	46,182,380 (GRCm38)	nonsense	probably null
R5174:Dnah7b	UTSW	1	46,243,349 (GRCm38)	missense	possibly damaging	0.83
R5178:Dnah7b	UTSW	1	46,358,216 (GRCm38)	missense	possibly damaging	0.50
R5244:Dnah7b	UTSW	1	46,233,858 (GRCm38)	missense	probably damaging	1.00
R5250:Dnah7b	UTSW	1	46,373,354 (GRCm38)	missense	probably damaging	1.00
R5350:Dnah7b	UTSW	1	46,233,689 (GRCm38)	missense	probably benign	0.16
R5380:Dnah7b	UTSW	1	46,217,191 (GRCm38)	missense	probably benign	0.18
R5387:Dnah7b	UTSW	1	46,188,659 (GRCm38)	missense	probably damaging	1.00
R5423:Dnah7b	UTSW	1	46,358,271 (GRCm38)	missense	probably benign	0.01
R5426:Dnah7b	UTSW	1	46,242,206 (GRCm38)	missense	possibly damaging	0.82
R5451:Dnah7b	UTSW	1	46,242,019 (GRCm38)	missense	possibly damaging	0.73
R5459:Dnah7b	UTSW	1	46,109,312 (GRCm38)	missense	probably null
R5479:Dnah7b	UTSW	1	46,223,105 (GRCm38)	missense	probably damaging	1.00
R5583:Dnah7b	UTSW	1	46,242,199 (GRCm38)	missense	probably benign	0.06
R5637:Dnah7b	UTSW	1	46,356,514 (GRCm38)	missense	possibly damaging	0.95
R5641:Dnah7b	UTSW	1	46,268,764 (GRCm38)	splice site	probably null
R5659:Dnah7b	UTSW	1	46,352,849 (GRCm38)	missense	probably damaging	1.00
R5739:Dnah7b	UTSW	1	46,233,992 (GRCm38)	missense	probably damaging	1.00
R5759:Dnah7b	UTSW	1	46,277,120 (GRCm38)	missense	probably damaging	1.00
R5821:Dnah7b	UTSW	1	46,142,132 (GRCm38)	missense	possibly damaging	0.91
R5874:Dnah7b	UTSW	1	46,191,725 (GRCm38)	missense	probably damaging	1.00
R5892:Dnah7b	UTSW	1	46,337,593 (GRCm38)	critical splice donor site	probably null
R5918:Dnah7b	UTSW	1	46,221,643 (GRCm38)	missense	probably benign
R5941:Dnah7b	UTSW	1	46,187,290 (GRCm38)	missense	probably damaging	1.00
R5965:Dnah7b	UTSW	1	46,362,987 (GRCm38)	missense	probably damaging	1.00
R5987:Dnah7b	UTSW	1	46,119,398 (GRCm38)	splice site	probably null
R6041:Dnah7b	UTSW	1	46,289,645 (GRCm38)	missense	probably benign	0.04
R6043:Dnah7b	UTSW	1	46,139,789 (GRCm38)	missense	probably benign
R6049:Dnah7b	UTSW	1	46,085,602 (GRCm38)	missense	probably benign
R6131:Dnah7b	UTSW	1	46,253,466 (GRCm38)	missense	probably damaging	1.00
R6168:Dnah7b	UTSW	1	46,290,703 (GRCm38)	missense	probably damaging	1.00
R6195:Dnah7b	UTSW	1	46,204,269 (GRCm38)	missense	probably damaging	1.00
R6219:Dnah7b	UTSW	1	46,233,585 (GRCm38)	missense	probably benign	0.03
R6226:Dnah7b	UTSW	1	46,126,668 (GRCm38)	missense	probably benign	0.01
R6233:Dnah7b	UTSW	1	46,204,269 (GRCm38)	missense	probably damaging	1.00
R6247:Dnah7b	UTSW	1	46,225,888 (GRCm38)	missense	probably benign
R6273:Dnah7b	UTSW	1	46,242,316 (GRCm38)	missense	possibly damaging	0.94
R6279:Dnah7b	UTSW	1	46,325,886 (GRCm38)	missense	probably damaging	1.00
R6300:Dnah7b	UTSW	1	46,325,886 (GRCm38)	missense	probably damaging	1.00
R6330:Dnah7b	UTSW	1	46,340,175 (GRCm38)	missense	probably damaging	1.00
R6476:Dnah7b	UTSW	1	46,242,204 (GRCm38)	nonsense	probably null
R6494:Dnah7b	UTSW	1	46,099,431 (GRCm38)	missense	probably damaging	1.00
R6762:Dnah7b	UTSW	1	46,224,742 (GRCm38)	missense	probably benign	0.12
R6800:Dnah7b	UTSW	1	46,340,217 (GRCm38)	missense	possibly damaging	0.90
R6838:Dnah7b	UTSW	1	46,191,788 (GRCm38)	missense	probably damaging	1.00
R6937:Dnah7b	UTSW	1	46,195,120 (GRCm38)	missense	probably damaging	1.00
R6940:Dnah7b	UTSW	1	46,119,268 (GRCm38)	missense	probably benign	0.12
R6969:Dnah7b	UTSW	1	46,358,238 (GRCm38)	missense	probably damaging	1.00
R6993:Dnah7b	UTSW	1	46,195,139 (GRCm38)	critical splice donor site	probably null
R7040:Dnah7b	UTSW	1	46,236,809 (GRCm38)	missense	probably benign	0.01
R7117:Dnah7b	UTSW	1	46,352,813 (GRCm38)	critical splice acceptor site	probably null
R7135:Dnah7b	UTSW	1	46,139,710 (GRCm38)	missense	probably damaging	0.99
R7153:Dnah7b	UTSW	1	46,126,804 (GRCm38)	missense	probably benign	0.05
R7189:Dnah7b	UTSW	1	46,242,142 (GRCm38)	missense	probably damaging	1.00
R7237:Dnah7b	UTSW	1	46,139,966 (GRCm38)	missense	probably damaging	0.98
R7243:Dnah7b	UTSW	1	46,083,754 (GRCm38)	missense	probably benign
R7244:Dnah7b	UTSW	1	46,277,143 (GRCm38)	missense	probably damaging	0.99
R7248:Dnah7b	UTSW	1	46,142,085 (GRCm38)	missense	possibly damaging	0.83
R7318:Dnah7b	UTSW	1	46,195,372 (GRCm38)	missense	probably damaging	1.00
R7375:Dnah7b	UTSW	1	46,303,634 (GRCm38)	missense	probably damaging	1.00
R7483:Dnah7b	UTSW	1	46,175,419 (GRCm38)	missense	probably damaging	1.00
R7486:Dnah7b	UTSW	1	46,290,734 (GRCm38)	missense	probably damaging	1.00
R7498:Dnah7b	UTSW	1	46,325,765 (GRCm38)	missense	probably damaging	1.00
R7501:Dnah7b	UTSW	1	46,356,554 (GRCm38)	missense	probably damaging	1.00
R7513:Dnah7b	UTSW	1	46,124,346 (GRCm38)	missense	probably benign	0.06
R7547:Dnah7b	UTSW	1	46,214,413 (GRCm38)	missense	possibly damaging	0.82
R7620:Dnah7b	UTSW	1	46,268,634 (GRCm38)	missense	probably damaging	1.00
R7670:Dnah7b	UTSW	1	46,109,302 (GRCm38)	missense	probably benign
R7676:Dnah7b	UTSW	1	46,234,164 (GRCm38)	nonsense	probably null
R7731:Dnah7b	UTSW	1	46,139,745 (GRCm38)	missense	probably benign	0.00
R7760:Dnah7b	UTSW	1	46,201,253 (GRCm38)	missense	probably damaging	1.00
R7768:Dnah7b	UTSW	1	46,137,474 (GRCm38)	missense	probably benign
R7807:Dnah7b	UTSW	1	46,214,367 (GRCm38)	missense	probably benign
R7895:Dnah7b	UTSW	1	46,249,950 (GRCm38)	missense	probably damaging	1.00
R7911:Dnah7b	UTSW	1	46,139,678 (GRCm38)	missense	probably damaging	1.00
R7924:Dnah7b	UTSW	1	46,219,430 (GRCm38)	missense	probably benign	0.04
R7944:Dnah7b	UTSW	1	46,227,003 (GRCm38)	missense	probably benign
R7946:Dnah7b	UTSW	1	46,233,579 (GRCm38)	missense	probably damaging	1.00
R7983:Dnah7b	UTSW	1	46,243,424 (GRCm38)	missense	probably damaging	1.00
R8012:Dnah7b	UTSW	1	46,243,365 (GRCm38)	missense	probably damaging	1.00
R8069:Dnah7b	UTSW	1	46,224,706 (GRCm38)	nonsense	probably null
R8094:Dnah7b	UTSW	1	46,126,804 (GRCm38)	missense	probably benign	0.01
R8137:Dnah7b	UTSW	1	46,233,753 (GRCm38)	missense	probably damaging	1.00
R8167:Dnah7b	UTSW	1	46,253,511 (GRCm38)	missense	possibly damaging	0.95
R8268:Dnah7b	UTSW	1	46,356,576 (GRCm38)	missense	probably benign	0.43
R8309:Dnah7b	UTSW	1	46,139,872 (GRCm38)	missense	probably damaging	1.00
R8313:Dnah7b	UTSW	1	46,175,296 (GRCm38)	missense	possibly damaging	0.81
R8410:Dnah7b	UTSW	1	46,356,659 (GRCm38)	critical splice donor site	probably null
R8438:Dnah7b	UTSW	1	46,188,679 (GRCm38)	missense	probably damaging	1.00
R8446:Dnah7b	UTSW	1	46,290,715 (GRCm38)	missense	probably damaging	1.00
R8471:Dnah7b	UTSW	1	46,099,490 (GRCm38)	missense	possibly damaging	0.92
R8551:Dnah7b	UTSW	1	46,116,200 (GRCm38)	missense	possibly damaging	0.94
R8711:Dnah7b	UTSW	1	46,175,438 (GRCm38)	missense	probably damaging	1.00
R8745:Dnah7b	UTSW	1	46,182,464 (GRCm38)	missense	possibly damaging	0.82
R8765:Dnah7b	UTSW	1	46,352,999 (GRCm38)	missense	possibly damaging	0.91
R8797:Dnah7b	UTSW	1	46,123,646 (GRCm38)	missense	probably damaging	1.00
R8805:Dnah7b	UTSW	1	46,234,145 (GRCm38)	missense	possibly damaging	0.90
R8830:Dnah7b	UTSW	1	46,191,793 (GRCm38)	missense	probably damaging	1.00
R8861:Dnah7b	UTSW	1	46,241,076 (GRCm38)	missense	possibly damaging	0.82
R8905:Dnah7b	UTSW	1	46,253,374 (GRCm38)	missense	probably damaging	0.99
R9009:Dnah7b	UTSW	1	46,223,072 (GRCm38)	missense	probably benign	0.00
R9058:Dnah7b	UTSW	1	46,243,415 (GRCm38)	missense	probably damaging	1.00
R9130:Dnah7b	UTSW	1	46,134,514 (GRCm38)	missense	probably benign	0.01
R9131:Dnah7b	UTSW	1	46,227,020 (GRCm38)	missense	probably damaging	1.00
R9181:Dnah7b	UTSW	1	46,142,034 (GRCm38)	missense	probably damaging	1.00
R9182:Dnah7b	UTSW	1	46,290,878 (GRCm38)	missense	probably benign	0.06
R9223:Dnah7b	UTSW	1	46,322,260 (GRCm38)	missense	probably benign	0.12
R9391:Dnah7b	UTSW	1	46,233,754 (GRCm38)	nonsense	probably null
R9392:Dnah7b	UTSW	1	46,123,738 (GRCm38)	nonsense	probably null
R9456:Dnah7b	UTSW	1	46,126,793 (GRCm38)	missense	possibly damaging	0.82
R9498:Dnah7b	UTSW	1	46,214,404 (GRCm38)	missense	probably benign	0.27
R9553:Dnah7b	UTSW	1	46,225,796 (GRCm38)	missense	probably damaging	0.99
R9598:Dnah7b	UTSW	1	46,253,461 (GRCm38)	missense	possibly damaging	0.67
R9653:Dnah7b	UTSW	1	46,213,384 (GRCm38)	missense	possibly damaging	0.55
R9781:Dnah7b	UTSW	1	46,337,594 (GRCm38)	splice site	probably null
RF020:Dnah7b	UTSW	1	46,373,261 (GRCm38)	missense	possibly damaging	0.84
V8831:Dnah7b	UTSW	1	46,373,298 (GRCm38)	nonsense	probably null
X0023:Dnah7b	UTSW	1	46,303,577 (GRCm38)	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CATCAACCTGCAATTGAGCATGTACTC -3'
(R):5'- GCAAAATCAGCCAAGGGAATGTGTC -3'

Sequencing Primer
(F):5'- CTTTGGCTTCCAGGAAATAGC -3'
(R):5'- CCAAGGGAATGTGTCAAAATTAGGTG -3'

Posted On

2014-02-18