Incidental Mutation 'R1318:Cdh15'
ID 157606
Institutional Source Beutler Lab
Gene Symbol Cdh15
Ensembl Gene ENSMUSG00000031962
Gene Name cadherin 15
Synonyms M cadherin, Mcad, Cdh14
MMRRC Submission 039384-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1318 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 123575113-123594136 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 123584234 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 112 (E112Q)
Ref Sequence ENSEMBL: ENSMUSP00000034443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]
AlphaFold P33146
Predicted Effect probably damaging
Transcript: ENSMUST00000034443
AA Change: E112Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: E112Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 64 149 5.95e-18 SMART
CA 173 257 3.09e-25 SMART
CA 280 373 2.5e-11 SMART
CA 396 480 3.45e-14 SMART
Pfam:Cadherin 486 579 5.2e-9 PFAM
transmembrane domain 603 625 N/A INTRINSIC
Pfam:Cadherin_C 633 783 6.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Meta Mutation Damage Score 0.5702 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G T 5: 8,751,621 (GRCm39) V334L probably benign Het
Alms1 T G 6: 85,605,531 (GRCm39) S1925A possibly damaging Het
Comt G T 16: 18,226,641 (GRCm39) D248E probably damaging Het
Ctnna2 A C 6: 76,859,773 (GRCm39) N874K probably damaging Het
Dnah7b C T 1: 46,138,669 (GRCm39) P237L possibly damaging Het
Galnt4 T G 10: 98,945,772 (GRCm39) V499G probably damaging Het
Gh T C 11: 106,191,923 (GRCm39) T96A probably benign Het
Gng8 T C 7: 16,629,161 (GRCm39) V29A probably damaging Het
Hnrnpu G A 1: 178,157,822 (GRCm39) probably benign Het
Igdcc4 T C 9: 65,040,972 (GRCm39) L1001P probably damaging Het
Jph1 A C 1: 17,067,714 (GRCm39) F658V probably damaging Het
Kcnj3 A T 2: 55,327,750 (GRCm39) M180L possibly damaging Het
Ldb2 C T 5: 44,692,379 (GRCm39) probably null Het
Mettl2 C A 11: 105,028,597 (GRCm39) Y316* probably null Het
Mug2 G A 6: 122,054,361 (GRCm39) V1047M probably damaging Het
Mxra8 G T 4: 155,925,956 (GRCm39) C140F probably damaging Het
Mylip T C 13: 45,559,401 (GRCm39) I101T probably benign Het
Oasl2 A G 5: 115,039,442 (GRCm39) N210S probably benign Het
Pclo A G 5: 14,729,328 (GRCm39) probably benign Het
Plaat3 T A 19: 7,556,591 (GRCm39) probably null Het
Rims2 G A 15: 39,381,222 (GRCm39) R1051H probably damaging Het
Rnf4 C A 5: 34,508,590 (GRCm39) R151S probably damaging Het
Serpina11 A T 12: 103,952,777 (GRCm39) probably benign Het
Trim30b T A 7: 104,006,542 (GRCm39) T105S possibly damaging Het
Ttn T C 2: 76,706,164 (GRCm39) probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,578,962 (GRCm39) probably benign Het
Zranb1 C A 7: 132,568,281 (GRCm39) S313* probably null Het
Other mutations in Cdh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cdh15 APN 8 123,592,062 (GRCm39) intron probably benign
IGL01958:Cdh15 APN 8 123,586,089 (GRCm39) missense probably damaging 1.00
IGL02588:Cdh15 APN 8 123,583,291 (GRCm39) nonsense probably null
IGL02793:Cdh15 APN 8 123,587,721 (GRCm39) missense probably damaging 1.00
IGL02947:Cdh15 APN 8 123,592,111 (GRCm39) missense probably benign 0.00
R0310:Cdh15 UTSW 8 123,592,175 (GRCm39) missense probably damaging 1.00
R0441:Cdh15 UTSW 8 123,587,705 (GRCm39) missense probably damaging 1.00
R0766:Cdh15 UTSW 8 123,588,188 (GRCm39) intron probably benign
R0898:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1023:Cdh15 UTSW 8 123,591,939 (GRCm39) missense probably damaging 0.98
R1054:Cdh15 UTSW 8 123,591,076 (GRCm39) missense possibly damaging 0.85
R1072:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R1081:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1101:Cdh15 UTSW 8 123,587,585 (GRCm39) missense possibly damaging 0.93
R1208:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1208:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1209:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1210:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1312:Cdh15 UTSW 8 123,588,188 (GRCm39) intron probably benign
R1317:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1393:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1428:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1429:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1695:Cdh15 UTSW 8 123,588,755 (GRCm39) missense probably benign 0.05
R2157:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2170:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2178:Cdh15 UTSW 8 123,591,715 (GRCm39) splice site probably null
R2252:Cdh15 UTSW 8 123,584,161 (GRCm39) missense probably damaging 1.00
R2290:Cdh15 UTSW 8 123,586,056 (GRCm39) missense probably damaging 1.00
R2317:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2330:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2345:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2349:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2353:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2354:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2566:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2567:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2568:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2893:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2894:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2937:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2938:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2990:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2992:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2993:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3029:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3030:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3195:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R3441:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3442:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3608:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3686:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R4119:Cdh15 UTSW 8 123,590,162 (GRCm39) missense probably damaging 1.00
R4120:Cdh15 UTSW 8 123,590,162 (GRCm39) missense probably damaging 1.00
R4477:Cdh15 UTSW 8 123,591,415 (GRCm39) missense probably benign 0.00
R4478:Cdh15 UTSW 8 123,591,415 (GRCm39) missense probably benign 0.00
R4480:Cdh15 UTSW 8 123,591,415 (GRCm39) missense probably benign 0.00
R4580:Cdh15 UTSW 8 123,591,897 (GRCm39) missense probably damaging 0.99
R4583:Cdh15 UTSW 8 123,591,767 (GRCm39) missense probably damaging 0.98
R4619:Cdh15 UTSW 8 123,587,612 (GRCm39) missense probably damaging 1.00
R4694:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R4731:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R5076:Cdh15 UTSW 8 123,591,087 (GRCm39) missense possibly damaging 0.82
R5347:Cdh15 UTSW 8 123,588,802 (GRCm39) missense probably null 1.00
R5375:Cdh15 UTSW 8 123,591,839 (GRCm39) missense probably damaging 1.00
R5498:Cdh15 UTSW 8 123,591,917 (GRCm39) missense possibly damaging 0.79
R5778:Cdh15 UTSW 8 123,583,326 (GRCm39) missense possibly damaging 0.80
R6320:Cdh15 UTSW 8 123,591,086 (GRCm39) missense probably benign 0.01
R6570:Cdh15 UTSW 8 123,584,130 (GRCm39) missense probably damaging 1.00
R6708:Cdh15 UTSW 8 123,590,294 (GRCm39) missense probably benign 0.32
R7505:Cdh15 UTSW 8 123,575,231 (GRCm39) missense probably benign 0.01
R7527:Cdh15 UTSW 8 123,588,865 (GRCm39) missense probably damaging 1.00
R7724:Cdh15 UTSW 8 123,593,700 (GRCm39) missense probably damaging 1.00
R8093:Cdh15 UTSW 8 123,593,574 (GRCm39) missense probably damaging 1.00
R8485:Cdh15 UTSW 8 123,584,105 (GRCm39) missense probably damaging 1.00
R8759:Cdh15 UTSW 8 123,587,628 (GRCm39) missense probably damaging 1.00
R8910:Cdh15 UTSW 8 123,575,240 (GRCm39) missense probably benign 0.04
R9017:Cdh15 UTSW 8 123,584,256 (GRCm39) critical splice donor site probably null
R9453:Cdh15 UTSW 8 123,586,029 (GRCm39) missense probably damaging 0.99
R9699:Cdh15 UTSW 8 123,588,769 (GRCm39) missense probably benign 0.00
R9705:Cdh15 UTSW 8 123,591,024 (GRCm39) missense probably damaging 1.00
Z1176:Cdh15 UTSW 8 123,590,998 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTGTTGGGGTGAAACACGAAG -3'
(R):5'- ACAGTGATGCTCTGCTCTCCAAAAG -3'

Sequencing Primer
(F):5'- CACGAAGGTATTGGGGTGC -3'
(R):5'- ACCTATTCGCGGCCTCAAG -3'
Posted On 2014-02-18