Incidental Mutation 'R1319:Mcm6'
ID 157619
Institutional Source Beutler Lab
Gene Symbol Mcm6
Ensembl Gene ENSMUSG00000026355
Gene Name minichromosome maintenance complex component 6
Synonyms D1Wsu22e, Mcmd6
MMRRC Submission 039385-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1319 (G1)
Quality Score 215
Status Not validated
Chromosome 1
Chromosomal Location 128259327-128287401 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128276789 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 267 (N267S)
Ref Sequence ENSEMBL: ENSMUSP00000140308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027601] [ENSMUST00000190495]
AlphaFold P97311
Predicted Effect probably benign
Transcript: ENSMUST00000027601
AA Change: N267S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027601
Gene: ENSMUSG00000026355
AA Change: N267S

DomainStartEndE-ValueType
MCM 119 657 1.43e-270 SMART
PDB:2LE8|A 710 821 1e-47 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000190495
AA Change: N267S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140308
Gene: ENSMUSG00000026355
AA Change: N267S

DomainStartEndE-ValueType
MCM 119 657 1.43e-270 SMART
PDB:2LE8|A 710 783 3e-29 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191454
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 4 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of the complex by CDC2 kinase reduces the helicase activity, suggesting a role in the regulation of DNA replication. Single nucleotide polymorphisms in the intron regions of this gene are associated with differential transcriptional activation of the promoter of the neighboring lactase gene and, thereby, influence lactose intolerance in early adulthood. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit increased micronulei-containing red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam28 T C 14: 68,846,578 (GRCm39) E745G probably benign Het
Adamts12 G T 15: 11,286,877 (GRCm39) K827N probably benign Het
Ang2 T C 14: 51,433,164 (GRCm39) T73A probably benign Het
Bbs10 T C 10: 111,134,735 (GRCm39) L51P probably damaging Het
Bean1 T C 8: 104,943,856 (GRCm39) I137T probably benign Het
Cimip1 A T 2: 173,369,716 (GRCm39) S77C probably damaging Het
Cttnbp2 T C 6: 18,434,629 (GRCm39) T410A probably benign Het
Cyp4a10 A C 4: 115,378,342 (GRCm39) I143L probably damaging Het
Dlg2 A T 7: 92,087,231 (GRCm39) Q788L probably damaging Het
Epha10 G A 4: 124,775,707 (GRCm39) V14I probably benign Het
Eprs1 G A 1: 185,117,159 (GRCm39) D401N probably damaging Het
Fam169a T C 13: 97,234,070 (GRCm39) V114A probably damaging Het
Fbn2 G A 18: 58,333,682 (GRCm39) P178S possibly damaging Het
Fcrl2 A C 3: 87,169,484 (GRCm39) probably null Het
Grm1 G T 10: 10,565,142 (GRCm39) H1055Q probably benign Het
Or5an1c T C 19: 12,218,866 (GRCm39) D53G probably damaging Het
Phc3 T C 3: 30,984,018 (GRCm39) I699V probably damaging Het
Prl2c2 G C 13: 13,176,786 (GRCm39) T47R probably damaging Het
Pyroxd1 T C 6: 142,304,874 (GRCm39) V367A probably benign Het
R3hdm1 G A 1: 128,159,142 (GRCm39) R939H probably benign Het
Rag1 A T 2: 101,473,537 (GRCm39) I535N probably damaging Het
Rhot1 T C 11: 80,136,847 (GRCm39) C310R probably damaging Het
Tnrc6a G A 7: 122,783,474 (GRCm39) V1481M probably benign Het
Vmn1r234 A T 17: 21,449,172 (GRCm39) M29L probably benign Het
Vmn2r68 A G 7: 84,881,700 (GRCm39) I460T probably damaging Het
Zfhx3 T A 8: 109,660,465 (GRCm39) Y1240N probably damaging Het
Other mutations in Mcm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Mcm6 APN 1 128,272,120 (GRCm39) missense probably damaging 1.00
IGL01420:Mcm6 APN 1 128,273,612 (GRCm39) missense probably damaging 1.00
IGL01746:Mcm6 APN 1 128,281,261 (GRCm39) nonsense probably null
IGL02256:Mcm6 APN 1 128,263,465 (GRCm39) critical splice donor site probably null
IGL02624:Mcm6 APN 1 128,277,185 (GRCm39) missense possibly damaging 0.91
IGL02732:Mcm6 APN 1 128,287,227 (GRCm39) missense probably benign 0.16
IGL02750:Mcm6 APN 1 128,271,209 (GRCm39) missense probably damaging 1.00
IGL02926:Mcm6 APN 1 128,267,119 (GRCm39) missense probably damaging 1.00
IGL03189:Mcm6 APN 1 128,272,039 (GRCm39) missense probably damaging 1.00
IGL03238:Mcm6 APN 1 128,283,257 (GRCm39) missense probably benign 0.13
IGL03397:Mcm6 APN 1 128,272,039 (GRCm39) missense probably damaging 1.00
R0453:Mcm6 UTSW 1 128,261,292 (GRCm39) missense probably benign 0.00
R0501:Mcm6 UTSW 1 128,283,373 (GRCm39) missense probably benign 0.03
R0885:Mcm6 UTSW 1 128,276,670 (GRCm39) missense probably benign 0.00
R1013:Mcm6 UTSW 1 128,276,778 (GRCm39) missense probably benign
R1396:Mcm6 UTSW 1 128,279,213 (GRCm39) missense probably damaging 1.00
R1656:Mcm6 UTSW 1 128,277,155 (GRCm39) missense possibly damaging 0.90
R1891:Mcm6 UTSW 1 128,263,547 (GRCm39) missense probably damaging 1.00
R1950:Mcm6 UTSW 1 128,273,726 (GRCm39) missense probably benign 0.35
R3411:Mcm6 UTSW 1 128,279,322 (GRCm39) missense probably benign 0.35
R4564:Mcm6 UTSW 1 128,271,196 (GRCm39) missense probably damaging 1.00
R4626:Mcm6 UTSW 1 128,279,285 (GRCm39) missense probably benign 0.01
R4627:Mcm6 UTSW 1 128,279,285 (GRCm39) missense probably benign 0.01
R4628:Mcm6 UTSW 1 128,279,285 (GRCm39) missense probably benign 0.01
R4916:Mcm6 UTSW 1 128,276,714 (GRCm39) missense probably damaging 1.00
R4965:Mcm6 UTSW 1 128,287,223 (GRCm39) missense probably damaging 1.00
R4967:Mcm6 UTSW 1 128,263,586 (GRCm39) missense probably damaging 1.00
R5016:Mcm6 UTSW 1 128,271,164 (GRCm39) missense probably damaging 1.00
R5204:Mcm6 UTSW 1 128,261,375 (GRCm39) missense probably benign 0.01
R5229:Mcm6 UTSW 1 128,261,321 (GRCm39) missense possibly damaging 0.82
R5607:Mcm6 UTSW 1 128,283,326 (GRCm39) missense probably damaging 1.00
R5811:Mcm6 UTSW 1 128,263,465 (GRCm39) critical splice donor site probably benign
R5816:Mcm6 UTSW 1 128,276,192 (GRCm39) missense probably benign 0.01
R7204:Mcm6 UTSW 1 128,265,864 (GRCm39) missense probably damaging 1.00
R7316:Mcm6 UTSW 1 128,287,245 (GRCm39) missense probably damaging 1.00
R8081:Mcm6 UTSW 1 128,265,905 (GRCm39) missense probably damaging 1.00
R8546:Mcm6 UTSW 1 128,273,685 (GRCm39) missense possibly damaging 0.91
R8547:Mcm6 UTSW 1 128,273,685 (GRCm39) missense possibly damaging 0.91
R8549:Mcm6 UTSW 1 128,273,685 (GRCm39) missense possibly damaging 0.91
R8785:Mcm6 UTSW 1 128,262,535 (GRCm39) missense probably benign 0.15
R8878:Mcm6 UTSW 1 128,283,248 (GRCm39) critical splice donor site probably null
R9043:Mcm6 UTSW 1 128,271,231 (GRCm39) missense probably damaging 1.00
R9253:Mcm6 UTSW 1 128,279,264 (GRCm39) missense probably damaging 1.00
Z1088:Mcm6 UTSW 1 128,272,035 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGAGGATGGAGCCCAATTCCTAC -3'
(R):5'- CTGGCTACCAATCAGGATGAGCAC -3'

Sequencing Primer
(F):5'- gagcccaattcctacctacc -3'
(R):5'- TACCAATCAGGATGAGCACAGAAG -3'
Posted On 2014-02-18