Mutagenetix > Incidental Mutations

Incidental Mutation 'R1319:Eprs'

157620

Institutional Source

Beutler Lab

Gene Symbol

Eprs

Ensembl Gene

ENSMUSG00000026615

Gene Name

glutamyl-prolyl-tRNA synthetase

Synonyms

2410081F06Rik, 3010002K18Rik, Qprs

MMRRC Submission

039385-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1319 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

185363044-185428360 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 185384962 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 401 (D401N)

Ref Sequence

ENSEMBL: ENSMUSP00000045841 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046514] [ENSMUST00000191900]

AlphaFold

Q8CGC7

Predicted Effect

probably damaging
Transcript: ENSMUST00000046514
AA Change: D401N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045841
Gene: ENSMUSG00000026615
AA Change: D401N

Domain	Start	End	E-Value	Type
Pfam:GST_C_3	71	156	2.1e-15	PFAM
Pfam:GST_C	72	157	2.9e-7	PFAM
Pfam:tRNA-synt_1c	197	502	8.8e-127	PFAM
Pfam:tRNA-synt_1c_C	504	681	4.4e-42	PFAM
WHEP-TRS	753	815	1.26e-25	SMART
WHEP-TRS	826	888	1.47e-26	SMART
WHEP-TRS	904	966	3.76e-24	SMART
low complexity region	984	1011	N/A	INTRINSIC
Pfam:tRNA-synt_2b	1107	1287	3.1e-17	PFAM
Pfam:HGTP_anticodon	1303	1404	1.7e-19	PFAM
ProRS-C_1	1430	1512	5.27e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000191900

SMART Domains

Protein: ENSMUSP00000141467
Gene: ENSMUSG00000026615

Domain	Start	End	E-Value	Type
Pfam:GST_C	66	131	1.7e-4	PFAM
Pfam:GST_C_3	70	131	8.9e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192284

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 90.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a multifunctional aminoacyl-tRNA synthetase that catalyzes the aminoacylation of glutamic acid and proline tRNA species. Alternative splicing has been observed for this gene, but the full-length nature and biological validity of the variant have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a phospho-mimetic allele exhibit normal body weight, life span and glucose metabolism. Mice homozygous for a phospho-deficient allele exhibit decrease body weight, enhanced lipolysis, altered glucose metabolism and increased energy expenditure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021F07Rik	A	T	2: 173,527,923	S77C	probably damaging	Het
Adam28	T	C	14: 68,609,129	E745G	probably benign	Het
Adamts12	G	T	15: 11,286,791	K827N	probably benign	Het
Ang2	T	C	14: 51,195,707	T73A	probably benign	Het
Bbs10	T	C	10: 111,298,874	L51P	probably damaging	Het
Bean1	T	C	8: 104,217,224	I137T	probably benign	Het
Cttnbp2	T	C	6: 18,434,630	T410A	probably benign	Het
Cyp4a10	A	C	4: 115,521,145	I143L	probably damaging	Het
Dlg2	A	T	7: 92,438,023	Q788L	probably damaging	Het
Epha10	G	A	4: 124,881,914	V14I	probably benign	Het
Fam169a	T	C	13: 97,097,562	V114A	probably damaging	Het
Fbn2	G	A	18: 58,200,610	P178S	possibly damaging	Het
Fcrls	A	C	3: 87,262,177		probably null	Het
Grm1	G	T	10: 10,689,398	H1055Q	probably benign	Het
Mcm6	T	C	1: 128,349,052	N267S	probably benign	Het
Olfr262	T	C	19: 12,241,502	D53G	probably damaging	Het
Phc3	T	C	3: 30,929,869	I699V	probably damaging	Het
Prl2c2	G	C	13: 13,002,201	T47R	probably damaging	Het
Pyroxd1	T	C	6: 142,359,148	V367A	probably benign	Het
R3hdm1	G	A	1: 128,231,405	R939H	probably benign	Het
Rag1	A	T	2: 101,643,192	I535N	probably damaging	Het
Rhot1	T	C	11: 80,246,021	C310R	probably damaging	Het
Tnrc6a	G	A	7: 123,184,251	V1481M	probably benign	Het
Vmn1r234	A	T	17: 21,228,910	M29L	probably benign	Het
Vmn2r68	A	G	7: 85,232,492	I460T	probably damaging	Het
Zfhx3	T	A	8: 108,933,833	Y1240N	probably damaging	Het

Other mutations in Eprs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00528:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00532:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00543:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00553:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00574:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00583:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00946:Eprs	APN	1	185407701	missense	probably benign	0.02
IGL01062:Eprs	APN	1	185379615	missense	probably benign	0.19
IGL01477:Eprs	APN	1	185411375	splice site	probably benign
IGL01608:Eprs	APN	1	185385114	unclassified	probably benign
IGL01767:Eprs	APN	1	185384915	missense	probably damaging	0.98
IGL02136:Eprs	APN	1	185384983	missense	probably damaging	1.00
IGL02302:Eprs	APN	1	185387124	splice site	probably benign
IGL02528:Eprs	APN	1	185413489	missense	probably damaging	1.00
IGL02631:Eprs	APN	1	185427898	missense	probably damaging	1.00
IGL02989:Eprs	APN	1	185418366	missense	probably benign	0.31
IGL03004:Eprs	APN	1	185381833	missense	probably damaging	1.00
R0003:Eprs	UTSW	1	185414391	missense	probably damaging	1.00
R0003:Eprs	UTSW	1	185414391	missense	probably damaging	1.00
R0179:Eprs	UTSW	1	185413547	missense	probably benign
R0783:Eprs	UTSW	1	185398458	missense	probably damaging	1.00
R1335:Eprs	UTSW	1	185387089	missense	probably damaging	1.00
R1514:Eprs	UTSW	1	185381834	missense	probably damaging	0.99
R1590:Eprs	UTSW	1	185401510	missense	probably damaging	1.00
R1688:Eprs	UTSW	1	185384896	missense	probably damaging	0.99
R1725:Eprs	UTSW	1	185406992	missense	probably damaging	1.00
R2182:Eprs	UTSW	1	185379742	splice site	probably null
R2228:Eprs	UTSW	1	185367537	missense	probably damaging	1.00
R2336:Eprs	UTSW	1	185411374	splice site	probably benign
R2338:Eprs	UTSW	1	185415808	missense	probably damaging	1.00
R2439:Eprs	UTSW	1	185379742	splice site	probably null
R2914:Eprs	UTSW	1	185379742	splice site	probably null
R3001:Eprs	UTSW	1	185424391	critical splice donor site	probably null
R3002:Eprs	UTSW	1	185424391	critical splice donor site	probably null
R3003:Eprs	UTSW	1	185424391	critical splice donor site	probably null
R3547:Eprs	UTSW	1	185379742	splice site	probably null
R3775:Eprs	UTSW	1	185373008	missense	probably damaging	1.00
R3878:Eprs	UTSW	1	185415953	critical splice donor site	probably null
R3902:Eprs	UTSW	1	185379742	splice site	probably null
R3913:Eprs	UTSW	1	185379742	splice site	probably null
R4579:Eprs	UTSW	1	185401607	missense	probably damaging	1.00
R4664:Eprs	UTSW	1	185373076	intron	probably benign
R4680:Eprs	UTSW	1	185386278	missense	possibly damaging	0.87
R4712:Eprs	UTSW	1	185428108	missense	probably benign	0.00
R4749:Eprs	UTSW	1	185396130	missense	probably damaging	0.97
R4995:Eprs	UTSW	1	185410139	intron	probably benign
R5154:Eprs	UTSW	1	185413465	missense	probably damaging	1.00
R5640:Eprs	UTSW	1	185374184	missense	probably benign	0.34
R5662:Eprs	UTSW	1	185394425	missense	possibly damaging	0.72
R6037:Eprs	UTSW	1	185396109	missense	probably damaging	1.00
R6037:Eprs	UTSW	1	185396109	missense	probably damaging	1.00
R6151:Eprs	UTSW	1	185407754	critical splice donor site	probably null
R6387:Eprs	UTSW	1	185387084	missense	possibly damaging	0.94
R6647:Eprs	UTSW	1	185414424	missense	probably damaging	1.00
R6701:Eprs	UTSW	1	185370890	missense	probably damaging	0.99
R6997:Eprs	UTSW	1	185396163	missense	possibly damaging	0.50
R7295:Eprs	UTSW	1	185418210	critical splice acceptor site	probably null
R7305:Eprs	UTSW	1	185379701	missense	probably damaging	1.00
R7729:Eprs	UTSW	1	185413169	missense	probably damaging	1.00
R7732:Eprs	UTSW	1	185372939	missense	probably benign	0.01
R7733:Eprs	UTSW	1	185397161	missense	probably benign
R7826:Eprs	UTSW	1	185406968	missense	probably damaging	0.96
R7988:Eprs	UTSW	1	185418348	missense	probably damaging	1.00
R8071:Eprs	UTSW	1	185394456	missense	possibly damaging	0.67
R8157:Eprs	UTSW	1	185398394	missense	probably benign	0.21
R8209:Eprs	UTSW	1	185407615	missense	possibly damaging	0.71
R8370:Eprs	UTSW	1	185399257	missense	probably damaging	0.98
R8493:Eprs	UTSW	1	185407174	nonsense	probably null
R8556:Eprs	UTSW	1	185420288	critical splice donor site	probably null
R8877:Eprs	UTSW	1	185415874	nonsense	probably null
R9096:Eprs	UTSW	1	185407106	missense	probably benign	0.03
R9097:Eprs	UTSW	1	185407106	missense	probably benign	0.03
R9112:Eprs	UTSW	1	185397076	missense	probably damaging	1.00
R9189:Eprs	UTSW	1	185374137	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GGCTGCTAATGTTTAAGATGGGGAAGAT -3'
(R):5'- CCACGCTCTGGCAGGAACAC -3'

Sequencing Primer
(F):5'- GCCCTATAGTGGACAGCATT -3'
(R):5'- CGTGTTTACAGCATTTAAGTCAAGG -3'

Posted On

2014-02-18