Incidental Mutation 'R1319:Fcrl2'
ID 157624
Institutional Source Beutler Lab
Gene Symbol Fcrl2
Ensembl Gene ENSMUSG00000015852
Gene Name Fc receptor like 2
Synonyms Fcrls, IFGP2, 2810439C17Rik, Msr2, Fcrh2, moFcRH2sc
MMRRC Submission 039385-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R1319 (G1)
Quality Score 124
Status Not validated
Chromosome 3
Chromosomal Location 87158318-87171046 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 87169484 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090986] [ENSMUST00000146512]
AlphaFold Q9EQY5
Predicted Effect probably null
Transcript: ENSMUST00000090986
SMART Domains Protein: ENSMUSP00000088508
Gene: ENSMUSG00000015852

DomainStartEndE-ValueType
IG 23 106 1.32e-3 SMART
IGc2 122 186 2.77e-6 SMART
IGc2 226 291 1.09e-4 SMART
IG 315 396 1e-3 SMART
SR 402 503 7.29e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000146512
SMART Domains Protein: ENSMUSP00000115780
Gene: ENSMUSG00000015852

DomainStartEndE-ValueType
IG 23 106 1.32e-3 SMART
Pfam:Ig_2 111 176 6.1e-6 PFAM
Pfam:Ig_3 111 176 1.4e-4 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female homozygous mutant mice are larger than controls and show increased mean body weight, total tissue mass, lean body mass and total body fat. Homozygous mutant mice eshow a decreased mean percentage of CD8 cells in the peripheral blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam28 T C 14: 68,846,578 (GRCm39) E745G probably benign Het
Adamts12 G T 15: 11,286,877 (GRCm39) K827N probably benign Het
Ang2 T C 14: 51,433,164 (GRCm39) T73A probably benign Het
Bbs10 T C 10: 111,134,735 (GRCm39) L51P probably damaging Het
Bean1 T C 8: 104,943,856 (GRCm39) I137T probably benign Het
Cimip1 A T 2: 173,369,716 (GRCm39) S77C probably damaging Het
Cttnbp2 T C 6: 18,434,629 (GRCm39) T410A probably benign Het
Cyp4a10 A C 4: 115,378,342 (GRCm39) I143L probably damaging Het
Dlg2 A T 7: 92,087,231 (GRCm39) Q788L probably damaging Het
Epha10 G A 4: 124,775,707 (GRCm39) V14I probably benign Het
Eprs1 G A 1: 185,117,159 (GRCm39) D401N probably damaging Het
Fam169a T C 13: 97,234,070 (GRCm39) V114A probably damaging Het
Fbn2 G A 18: 58,333,682 (GRCm39) P178S possibly damaging Het
Grm1 G T 10: 10,565,142 (GRCm39) H1055Q probably benign Het
Mcm6 T C 1: 128,276,789 (GRCm39) N267S probably benign Het
Or5an1c T C 19: 12,218,866 (GRCm39) D53G probably damaging Het
Phc3 T C 3: 30,984,018 (GRCm39) I699V probably damaging Het
Prl2c2 G C 13: 13,176,786 (GRCm39) T47R probably damaging Het
Pyroxd1 T C 6: 142,304,874 (GRCm39) V367A probably benign Het
R3hdm1 G A 1: 128,159,142 (GRCm39) R939H probably benign Het
Rag1 A T 2: 101,473,537 (GRCm39) I535N probably damaging Het
Rhot1 T C 11: 80,136,847 (GRCm39) C310R probably damaging Het
Tnrc6a G A 7: 122,783,474 (GRCm39) V1481M probably benign Het
Vmn1r234 A T 17: 21,449,172 (GRCm39) M29L probably benign Het
Vmn2r68 A G 7: 84,881,700 (GRCm39) I460T probably damaging Het
Zfhx3 T A 8: 109,660,465 (GRCm39) Y1240N probably damaging Het
Other mutations in Fcrl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Fcrl2 APN 3 87,163,986 (GRCm39) missense probably damaging 0.99
IGL01959:Fcrl2 APN 3 87,166,939 (GRCm39) missense probably damaging 0.97
IGL02409:Fcrl2 APN 3 87,160,030 (GRCm39) missense probably benign 0.00
IGL02677:Fcrl2 APN 3 87,166,694 (GRCm39) missense probably benign 0.01
IGL02957:Fcrl2 APN 3 87,169,501 (GRCm39) missense possibly damaging 0.59
IGL02974:Fcrl2 APN 3 87,164,704 (GRCm39) missense possibly damaging 0.89
IGL02992:Fcrl2 APN 3 87,166,773 (GRCm39) missense probably damaging 0.99
BB001:Fcrl2 UTSW 3 87,166,840 (GRCm39) missense probably damaging 0.99
BB011:Fcrl2 UTSW 3 87,166,840 (GRCm39) missense probably damaging 0.99
R0052:Fcrl2 UTSW 3 87,164,085 (GRCm39) missense possibly damaging 0.94
R0052:Fcrl2 UTSW 3 87,164,085 (GRCm39) missense possibly damaging 0.94
R0131:Fcrl2 UTSW 3 87,166,266 (GRCm39) missense possibly damaging 0.90
R1171:Fcrl2 UTSW 3 87,164,167 (GRCm39) missense probably benign 0.24
R1522:Fcrl2 UTSW 3 87,164,014 (GRCm39) missense possibly damaging 0.64
R1696:Fcrl2 UTSW 3 87,166,825 (GRCm39) missense possibly damaging 0.95
R1742:Fcrl2 UTSW 3 87,166,350 (GRCm39) missense possibly damaging 0.76
R2156:Fcrl2 UTSW 3 87,164,648 (GRCm39) missense probably benign 0.43
R2255:Fcrl2 UTSW 3 87,164,655 (GRCm39) nonsense probably null
R2257:Fcrl2 UTSW 3 87,166,928 (GRCm39) missense probably damaging 0.99
R2434:Fcrl2 UTSW 3 87,164,005 (GRCm39) missense probably damaging 1.00
R2680:Fcrl2 UTSW 3 87,164,656 (GRCm39) missense probably damaging 0.99
R3552:Fcrl2 UTSW 3 87,166,717 (GRCm39) missense possibly damaging 0.73
R4866:Fcrl2 UTSW 3 87,170,773 (GRCm39) missense possibly damaging 0.65
R4883:Fcrl2 UTSW 3 87,166,922 (GRCm39) missense possibly damaging 0.48
R5654:Fcrl2 UTSW 3 87,164,851 (GRCm39) missense probably benign
R5771:Fcrl2 UTSW 3 87,170,775 (GRCm39) missense probably damaging 0.98
R5917:Fcrl2 UTSW 3 87,164,094 (GRCm39) missense probably damaging 0.99
R6349:Fcrl2 UTSW 3 87,159,803 (GRCm39) missense probably damaging 0.99
R6562:Fcrl2 UTSW 3 87,164,635 (GRCm39) missense probably benign
R6954:Fcrl2 UTSW 3 87,170,983 (GRCm39) critical splice donor site probably benign
R7059:Fcrl2 UTSW 3 87,164,647 (GRCm39) missense possibly damaging 0.82
R7188:Fcrl2 UTSW 3 87,166,830 (GRCm39) missense probably benign 0.13
R7201:Fcrl2 UTSW 3 87,159,934 (GRCm39) missense probably damaging 0.99
R7369:Fcrl2 UTSW 3 87,164,008 (GRCm39) missense possibly damaging 0.59
R7431:Fcrl2 UTSW 3 87,166,233 (GRCm39) missense probably damaging 0.99
R7610:Fcrl2 UTSW 3 87,160,004 (GRCm39) missense probably damaging 1.00
R7924:Fcrl2 UTSW 3 87,166,840 (GRCm39) missense probably damaging 0.99
R8018:Fcrl2 UTSW 3 87,166,933 (GRCm39) nonsense probably null
R8280:Fcrl2 UTSW 3 87,166,364 (GRCm39) nonsense probably null
R8981:Fcrl2 UTSW 3 87,164,677 (GRCm39) missense probably damaging 1.00
R9368:Fcrl2 UTSW 3 87,164,906 (GRCm39) missense possibly damaging 0.59
R9477:Fcrl2 UTSW 3 87,159,803 (GRCm39) missense probably damaging 0.98
R9522:Fcrl2 UTSW 3 87,164,101 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCAAAACAGAGGTTGTGGCATACCC -3'
(R):5'- CTGCTTGCAAAAGACAAACTCCTGG -3'

Sequencing Primer
(F):5'- ATACCCTGGCCCTGCTG -3'
(R):5'- agatggaggaaaaagatagaggaac -3'
Posted On 2014-02-18