Incidental Mutation 'R1319:Fcrls'
ID 157624
Institutional Source Beutler Lab
Gene Symbol Fcrls
Ensembl Gene ENSMUSG00000015852
Gene Name Fc receptor-like S, scavenger receptor
Synonyms IFGP2, Msr2, Fcrh2, moFcRH2sc, 2810439C17Rik
MMRRC Submission 039385-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R1319 (G1)
Quality Score 124
Status Not validated
Chromosome 3
Chromosomal Location 87250758-87263738 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 87262177 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090986] [ENSMUST00000146512]
AlphaFold Q9EQY5
Predicted Effect probably null
Transcript: ENSMUST00000090986
SMART Domains Protein: ENSMUSP00000088508
Gene: ENSMUSG00000015852

DomainStartEndE-ValueType
IG 23 106 1.32e-3 SMART
IGc2 122 186 2.77e-6 SMART
IGc2 226 291 1.09e-4 SMART
IG 315 396 1e-3 SMART
SR 402 503 7.29e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000146512
SMART Domains Protein: ENSMUSP00000115780
Gene: ENSMUSG00000015852

DomainStartEndE-ValueType
IG 23 106 1.32e-3 SMART
Pfam:Ig_2 111 176 6.1e-6 PFAM
Pfam:Ig_3 111 176 1.4e-4 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female homozygous mutant mice are larger than controls and show increased mean body weight, total tissue mass, lean body mass and total body fat. Homozygous mutant mice eshow a decreased mean percentage of CD8 cells in the peripheral blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik A T 2: 173,527,923 S77C probably damaging Het
Adam28 T C 14: 68,609,129 E745G probably benign Het
Adamts12 G T 15: 11,286,791 K827N probably benign Het
Ang2 T C 14: 51,195,707 T73A probably benign Het
Bbs10 T C 10: 111,298,874 L51P probably damaging Het
Bean1 T C 8: 104,217,224 I137T probably benign Het
Cttnbp2 T C 6: 18,434,630 T410A probably benign Het
Cyp4a10 A C 4: 115,521,145 I143L probably damaging Het
Dlg2 A T 7: 92,438,023 Q788L probably damaging Het
Epha10 G A 4: 124,881,914 V14I probably benign Het
Eprs G A 1: 185,384,962 D401N probably damaging Het
Fam169a T C 13: 97,097,562 V114A probably damaging Het
Fbn2 G A 18: 58,200,610 P178S possibly damaging Het
Grm1 G T 10: 10,689,398 H1055Q probably benign Het
Mcm6 T C 1: 128,349,052 N267S probably benign Het
Olfr262 T C 19: 12,241,502 D53G probably damaging Het
Phc3 T C 3: 30,929,869 I699V probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Pyroxd1 T C 6: 142,359,148 V367A probably benign Het
R3hdm1 G A 1: 128,231,405 R939H probably benign Het
Rag1 A T 2: 101,643,192 I535N probably damaging Het
Rhot1 T C 11: 80,246,021 C310R probably damaging Het
Tnrc6a G A 7: 123,184,251 V1481M probably benign Het
Vmn1r234 A T 17: 21,228,910 M29L probably benign Het
Vmn2r68 A G 7: 85,232,492 I460T probably damaging Het
Zfhx3 T A 8: 108,933,833 Y1240N probably damaging Het
Other mutations in Fcrls
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Fcrls APN 3 87256679 missense probably damaging 0.99
IGL01959:Fcrls APN 3 87259632 missense probably damaging 0.97
IGL02409:Fcrls APN 3 87252723 missense probably benign 0.00
IGL02677:Fcrls APN 3 87259387 missense probably benign 0.01
IGL02957:Fcrls APN 3 87262194 missense possibly damaging 0.59
IGL02974:Fcrls APN 3 87257397 missense possibly damaging 0.89
IGL02992:Fcrls APN 3 87259466 missense probably damaging 0.99
BB001:Fcrls UTSW 3 87259533 missense probably damaging 0.99
BB011:Fcrls UTSW 3 87259533 missense probably damaging 0.99
R0052:Fcrls UTSW 3 87256778 missense possibly damaging 0.94
R0052:Fcrls UTSW 3 87256778 missense possibly damaging 0.94
R0131:Fcrls UTSW 3 87258959 missense possibly damaging 0.90
R1171:Fcrls UTSW 3 87256860 missense probably benign 0.24
R1522:Fcrls UTSW 3 87256707 missense possibly damaging 0.64
R1696:Fcrls UTSW 3 87259518 missense possibly damaging 0.95
R1742:Fcrls UTSW 3 87259043 missense possibly damaging 0.76
R2156:Fcrls UTSW 3 87257341 missense probably benign 0.43
R2255:Fcrls UTSW 3 87257348 nonsense probably null
R2257:Fcrls UTSW 3 87259621 missense probably damaging 0.99
R2434:Fcrls UTSW 3 87256698 missense probably damaging 1.00
R2680:Fcrls UTSW 3 87257349 missense probably damaging 0.99
R3552:Fcrls UTSW 3 87259410 missense possibly damaging 0.73
R4866:Fcrls UTSW 3 87263466 missense possibly damaging 0.65
R4883:Fcrls UTSW 3 87259615 missense possibly damaging 0.48
R5654:Fcrls UTSW 3 87257544 missense probably benign
R5771:Fcrls UTSW 3 87263468 missense probably damaging 0.98
R5917:Fcrls UTSW 3 87256787 missense probably damaging 0.99
R6349:Fcrls UTSW 3 87252496 missense probably damaging 0.99
R6562:Fcrls UTSW 3 87257328 missense probably benign
R6954:Fcrls UTSW 3 87263676 critical splice donor site probably benign
R7059:Fcrls UTSW 3 87257340 missense possibly damaging 0.82
R7188:Fcrls UTSW 3 87259523 missense probably benign 0.13
R7201:Fcrls UTSW 3 87252627 missense probably damaging 0.99
R7369:Fcrls UTSW 3 87256701 missense possibly damaging 0.59
R7431:Fcrls UTSW 3 87258926 missense probably damaging 0.99
R7610:Fcrls UTSW 3 87252697 missense probably damaging 1.00
R7924:Fcrls UTSW 3 87259533 missense probably damaging 0.99
R8018:Fcrls UTSW 3 87259626 nonsense probably null
R8280:Fcrls UTSW 3 87259057 nonsense probably null
R8981:Fcrls UTSW 3 87257370 missense probably damaging 1.00
R9368:Fcrls UTSW 3 87257599 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- GCAAAACAGAGGTTGTGGCATACCC -3'
(R):5'- CTGCTTGCAAAAGACAAACTCCTGG -3'

Sequencing Primer
(F):5'- ATACCCTGGCCCTGCTG -3'
(R):5'- agatggaggaaaaagatagaggaac -3'
Posted On 2014-02-18