Incidental Mutation 'R1319:Pyroxd1'
ID 157629
Institutional Source Beutler Lab
Gene Symbol Pyroxd1
Ensembl Gene ENSMUSG00000041671
Gene Name pyridine nucleotide-disulphide oxidoreductase domain 1
Synonyms
MMRRC Submission 039385-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1319 (G1)
Quality Score 210
Status Not validated
Chromosome 6
Chromosomal Location 142345654-142363257 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 142359148 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 367 (V367A)
Ref Sequence ENSEMBL: ENSMUSP00000036394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032370] [ENSMUST00000041852] [ENSMUST00000100832] [ENSMUST00000111803]
AlphaFold Q3TMV7
Predicted Effect probably benign
Transcript: ENSMUST00000032370
SMART Domains Protein: ENSMUSP00000032370
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 2.5e-27 SMART
HELICc 328 409 2.2e-26 SMART
Pfam:RQC 488 592 5.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041852
AA Change: V367A

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000036394
Gene: ENSMUSG00000041671
AA Change: V367A

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 8 234 2.2e-18 PFAM
Pfam:Pyr_redox_2 266 381 4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100832
SMART Domains Protein: ENSMUSP00000098394
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 6e-25 SMART
HELICc 328 409 5.51e-24 SMART
Pfam:RQC 488 592 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111803
SMART Domains Protein: ENSMUSP00000107434
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 6e-25 SMART
HELICc 328 409 5.51e-24 SMART
Pfam:RecQ_Zn_bind 420 479 2.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123289
Predicted Effect probably benign
Transcript: ENSMUST00000123912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138578
Predicted Effect probably benign
Transcript: ENSMUST00000141504
SMART Domains Protein: ENSMUSP00000119452
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
Pfam:RecQ_Zn_bind 10 69 7.1e-16 PFAM
Pfam:RQC 73 187 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154870
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik A T 2: 173,527,923 S77C probably damaging Het
Adam28 T C 14: 68,609,129 E745G probably benign Het
Adamts12 G T 15: 11,286,791 K827N probably benign Het
Ang2 T C 14: 51,195,707 T73A probably benign Het
Bbs10 T C 10: 111,298,874 L51P probably damaging Het
Bean1 T C 8: 104,217,224 I137T probably benign Het
Cttnbp2 T C 6: 18,434,630 T410A probably benign Het
Cyp4a10 A C 4: 115,521,145 I143L probably damaging Het
Dlg2 A T 7: 92,438,023 Q788L probably damaging Het
Epha10 G A 4: 124,881,914 V14I probably benign Het
Eprs G A 1: 185,384,962 D401N probably damaging Het
Fam169a T C 13: 97,097,562 V114A probably damaging Het
Fbn2 G A 18: 58,200,610 P178S possibly damaging Het
Fcrls A C 3: 87,262,177 probably null Het
Grm1 G T 10: 10,689,398 H1055Q probably benign Het
Mcm6 T C 1: 128,349,052 N267S probably benign Het
Olfr262 T C 19: 12,241,502 D53G probably damaging Het
Phc3 T C 3: 30,929,869 I699V probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
R3hdm1 G A 1: 128,231,405 R939H probably benign Het
Rag1 A T 2: 101,643,192 I535N probably damaging Het
Rhot1 T C 11: 80,246,021 C310R probably damaging Het
Tnrc6a G A 7: 123,184,251 V1481M probably benign Het
Vmn1r234 A T 17: 21,228,910 M29L probably benign Het
Vmn2r68 A G 7: 85,232,492 I460T probably damaging Het
Zfhx3 T A 8: 108,933,833 Y1240N probably damaging Het
Other mutations in Pyroxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Pyroxd1 APN 6 142361758 missense probably damaging 0.96
IGL01720:Pyroxd1 APN 6 142351058 splice site probably benign
IGL02139:Pyroxd1 APN 6 142354731 missense probably benign
IGL02930:Pyroxd1 APN 6 142359052 missense probably damaging 1.00
R0233:Pyroxd1 UTSW 6 142354630 missense possibly damaging 0.77
R0233:Pyroxd1 UTSW 6 142354630 missense possibly damaging 0.77
R0329:Pyroxd1 UTSW 6 142361976 missense probably benign 0.37
R0505:Pyroxd1 UTSW 6 142353562 missense possibly damaging 0.55
R0552:Pyroxd1 UTSW 6 142345737 missense probably benign 0.06
R1073:Pyroxd1 UTSW 6 142348644 critical splice donor site probably null
R2200:Pyroxd1 UTSW 6 142359082 missense probably benign 0.01
R4638:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4639:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4640:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4641:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4642:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4643:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4645:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4687:Pyroxd1 UTSW 6 142361868 missense probably benign 0.00
R5359:Pyroxd1 UTSW 6 142361991 missense probably damaging 1.00
R5688:Pyroxd1 UTSW 6 142353540 missense probably damaging 1.00
R6208:Pyroxd1 UTSW 6 142357456 missense probably benign 0.00
R6295:Pyroxd1 UTSW 6 142354753 missense probably benign 0.00
R7056:Pyroxd1 UTSW 6 142359082 missense probably benign 0.01
R7445:Pyroxd1 UTSW 6 142358501 missense probably benign 0.03
R8925:Pyroxd1 UTSW 6 142354711 missense probably damaging 1.00
R8927:Pyroxd1 UTSW 6 142354711 missense probably damaging 1.00
R8987:Pyroxd1 UTSW 6 142356525 missense
V1662:Pyroxd1 UTSW 6 142358443 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAAGTCACGCTCTGACCTTGTCATC -3'
(R):5'- CTGAGCCTGCAACTCCTTTAGTCTG -3'

Sequencing Primer
(F):5'- CCTTATACTAATGAAAAGCTGCTCAG -3'
(R):5'- TCAGTCTACTGTAATACTGTGTGAC -3'
Posted On 2014-02-18