Mutagenetix > Incidental Mutations

Incidental Mutation 'R1319:Pyroxd1'

157629

Institutional Source

Beutler Lab

Gene Symbol

Pyroxd1

Ensembl Gene

ENSMUSG00000041671

Gene Name

pyridine nucleotide-disulphide oxidoreductase domain 1

Synonyms

MMRRC Submission

039385-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1319 (G1)

Quality Score

210

Status

Not validated

Chromosome

Chromosomal Location

142345654-142363257 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 142359148 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 367 (V367A)

Ref Sequence

ENSEMBL: ENSMUSP00000036394 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032370] [ENSMUST00000041852] [ENSMUST00000100832] [ENSMUST00000111803]

AlphaFold

Q3TMV7

Predicted Effect

probably benign
Transcript: ENSMUST00000032370

SMART Domains

Protein: ENSMUSP00000032370
Gene: ENSMUSG00000030243

Domain	Start	End	E-Value	Type
coiled coil region	6	51	N/A	INTRINSIC
DEXDc	88	291	2.5e-27	SMART
HELICc	328	409	2.2e-26	SMART
Pfam:RQC	488	592	5.5e-6	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000041852
AA Change: V367A

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000036394
Gene: ENSMUSG00000041671
AA Change: V367A

Domain	Start	End	E-Value	Type
Pfam:Pyr_redox_2	8	234	2.2e-18	PFAM
Pfam:Pyr_redox_2	266	381	4e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000100832

SMART Domains

Protein: ENSMUSP00000098394
Gene: ENSMUSG00000030243

Domain	Start	End	E-Value	Type
coiled coil region	6	51	N/A	INTRINSIC
DEXDc	88	291	6e-25	SMART
HELICc	328	409	5.51e-24	SMART
Pfam:RQC	488	592	1.1e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111803

SMART Domains

Protein: ENSMUSP00000107434
Gene: ENSMUSG00000030243

Domain	Start	End	E-Value	Type
coiled coil region	6	51	N/A	INTRINSIC
DEXDc	88	291	6e-25	SMART
HELICc	328	409	5.51e-24	SMART
Pfam:RecQ_Zn_bind	420	479	2.5e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123289

Predicted Effect

probably benign
Transcript: ENSMUST00000123912

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137098

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138578

Predicted Effect

probably benign
Transcript: ENSMUST00000141504

SMART Domains

Protein: ENSMUSP00000119452
Gene: ENSMUSG00000030243

Domain	Start	End	E-Value	Type
Pfam:RecQ_Zn_bind	10	69	7.1e-16	PFAM
Pfam:RQC	73	187	2.5e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153912

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154870

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 90.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021F07Rik	A	T	2: 173,527,923	S77C	probably damaging	Het
Adam28	T	C	14: 68,609,129	E745G	probably benign	Het
Adamts12	G	T	15: 11,286,791	K827N	probably benign	Het
Ang2	T	C	14: 51,195,707	T73A	probably benign	Het
Bbs10	T	C	10: 111,298,874	L51P	probably damaging	Het
Bean1	T	C	8: 104,217,224	I137T	probably benign	Het
Cttnbp2	T	C	6: 18,434,630	T410A	probably benign	Het
Cyp4a10	A	C	4: 115,521,145	I143L	probably damaging	Het
Dlg2	A	T	7: 92,438,023	Q788L	probably damaging	Het
Epha10	G	A	4: 124,881,914	V14I	probably benign	Het
Eprs	G	A	1: 185,384,962	D401N	probably damaging	Het
Fam169a	T	C	13: 97,097,562	V114A	probably damaging	Het
Fbn2	G	A	18: 58,200,610	P178S	possibly damaging	Het
Fcrls	A	C	3: 87,262,177		probably null	Het
Grm1	G	T	10: 10,689,398	H1055Q	probably benign	Het
Mcm6	T	C	1: 128,349,052	N267S	probably benign	Het
Olfr262	T	C	19: 12,241,502	D53G	probably damaging	Het
Phc3	T	C	3: 30,929,869	I699V	probably damaging	Het
Prl2c2	G	C	13: 13,002,201	T47R	probably damaging	Het
R3hdm1	G	A	1: 128,231,405	R939H	probably benign	Het
Rag1	A	T	2: 101,643,192	I535N	probably damaging	Het
Rhot1	T	C	11: 80,246,021	C310R	probably damaging	Het
Tnrc6a	G	A	7: 123,184,251	V1481M	probably benign	Het
Vmn1r234	A	T	17: 21,228,910	M29L	probably benign	Het
Vmn2r68	A	G	7: 85,232,492	I460T	probably damaging	Het
Zfhx3	T	A	8: 108,933,833	Y1240N	probably damaging	Het

Other mutations in Pyroxd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01335:Pyroxd1	APN	6	142361758	missense	probably damaging	0.96
IGL01720:Pyroxd1	APN	6	142351058	splice site	probably benign
IGL02139:Pyroxd1	APN	6	142354731	missense	probably benign
IGL02930:Pyroxd1	APN	6	142359052	missense	probably damaging	1.00
R0233:Pyroxd1	UTSW	6	142354630	missense	possibly damaging	0.77
R0233:Pyroxd1	UTSW	6	142354630	missense	possibly damaging	0.77
R0329:Pyroxd1	UTSW	6	142361976	missense	probably benign	0.37
R0505:Pyroxd1	UTSW	6	142353562	missense	possibly damaging	0.55
R0552:Pyroxd1	UTSW	6	142345737	missense	probably benign	0.06
R1073:Pyroxd1	UTSW	6	142348644	critical splice donor site	probably null
R2200:Pyroxd1	UTSW	6	142359082	missense	probably benign	0.01
R4638:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4639:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4640:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4641:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4642:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4643:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4645:Pyroxd1	UTSW	6	142354741	nonsense	probably null
R4687:Pyroxd1	UTSW	6	142361868	missense	probably benign	0.00
R5359:Pyroxd1	UTSW	6	142361991	missense	probably damaging	1.00
R5688:Pyroxd1	UTSW	6	142353540	missense	probably damaging	1.00
R6208:Pyroxd1	UTSW	6	142357456	missense	probably benign	0.00
R6295:Pyroxd1	UTSW	6	142354753	missense	probably benign	0.00
R7056:Pyroxd1	UTSW	6	142359082	missense	probably benign	0.01
R7445:Pyroxd1	UTSW	6	142358501	missense	probably benign	0.03
R8925:Pyroxd1	UTSW	6	142354711	missense	probably damaging	1.00
R8927:Pyroxd1	UTSW	6	142354711	missense	probably damaging	1.00
R8987:Pyroxd1	UTSW	6	142356525	missense
V1662:Pyroxd1	UTSW	6	142358443	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AAAGTCACGCTCTGACCTTGTCATC -3'
(R):5'- CTGAGCCTGCAACTCCTTTAGTCTG -3'

Sequencing Primer
(F):5'- CCTTATACTAATGAAAAGCTGCTCAG -3'
(R):5'- TCAGTCTACTGTAATACTGTGTGAC -3'

Posted On

2014-02-18