Incidental Mutation 'R1319:Dlg2'
ID157631
Institutional Source Beutler Lab
Gene Symbol Dlg2
Ensembl Gene ENSMUSG00000052572
Gene Namediscs large MAGUK scaffold protein 2
SynonymsDlgh2, A330103J02Rik, Chapsyn-110, PSD93, B330007M19Rik, LOC382816, B230218P12Rik
MMRRC Submission 039385-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1319 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location90476672-92449247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92438023 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 788 (Q788L)
Ref Sequence ENSEMBL: ENSMUSP00000073885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074273] [ENSMUST00000098308] [ENSMUST00000107193] [ENSMUST00000107196] [ENSMUST00000231777]
Predicted Effect probably damaging
Transcript: ENSMUST00000074273
AA Change: Q788L

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073885
Gene: ENSMUSG00000052572
AA Change: Q788L

DomainStartEndE-ValueType
MAGUK_N_PEST 14 97 1.5e-47 SMART
PDZ 106 185 1.15e-23 SMART
PDZ 201 280 9.86e-23 SMART
PDZ 429 502 1.77e-24 SMART
low complexity region 523 530 N/A INTRINSIC
SH3 539 605 7.82e-10 SMART
low complexity region 631 644 N/A INTRINSIC
GuKc 679 858 2.6e-73 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098308
AA Change: Q399L

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095910
Gene: ENSMUSG00000052572
AA Change: Q399L

DomainStartEndE-ValueType
PDZ 26 99 1.77e-24 SMART
low complexity region 120 127 N/A INTRINSIC
SH3 136 202 7.82e-10 SMART
low complexity region 228 241 N/A INTRINSIC
GuKc 290 469 2.6e-73 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107193
AA Change: Q673L

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102811
Gene: ENSMUSG00000052572
AA Change: Q673L

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
PDZ 61 140 1.15e-23 SMART
PDZ 156 235 9.86e-23 SMART
PDZ 332 405 1.77e-24 SMART
low complexity region 426 433 N/A INTRINSIC
SH3 442 508 7.82e-10 SMART
GuKc 564 743 2.6e-73 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107196
AA Change: Q770L

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102814
Gene: ENSMUSG00000052572
AA Change: Q770L

DomainStartEndE-ValueType
MAGUK_N_PEST 14 97 1.5e-47 SMART
PDZ 106 185 1.15e-23 SMART
PDZ 201 280 9.86e-23 SMART
PDZ 429 502 1.77e-24 SMART
low complexity region 523 530 N/A INTRINSIC
SH3 539 605 7.82e-10 SMART
GuKc 661 840 2.6e-73 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207891
Predicted Effect probably damaging
Transcript: ENSMUST00000231777
AA Change: Q875L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) family. The encoded protein forms a heterodimer with a related family member that may interact at postsynaptic sites to form a multimeric scaffold for the clustering of receptors, ion channels, and associated signaling proteins. Multiple transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described, but their full-length nature is not known. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display lower surface expression of NMDA receptor (NMDAR) subunits NR2A and NR2B in dorsal horn neurons and significantly reduced NMDAR-mediated excitatory synaptic currents and NMDAR-dependent persistent inflammatory or nerve injury-induced neuropathic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik A T 2: 173,527,923 S77C probably damaging Het
Adam28 T C 14: 68,609,129 E745G probably benign Het
Adamts12 G T 15: 11,286,791 K827N probably benign Het
Ang2 T C 14: 51,195,707 T73A probably benign Het
Bbs10 T C 10: 111,298,874 L51P probably damaging Het
Bean1 T C 8: 104,217,224 I137T probably benign Het
Cttnbp2 T C 6: 18,434,630 T410A probably benign Het
Cyp4a10 A C 4: 115,521,145 I143L probably damaging Het
Epha10 G A 4: 124,881,914 V14I probably benign Het
Eprs G A 1: 185,384,962 D401N probably damaging Het
Fam169a T C 13: 97,097,562 V114A probably damaging Het
Fbn2 G A 18: 58,200,610 P178S possibly damaging Het
Fcrls A C 3: 87,262,177 probably null Het
Grm1 G T 10: 10,689,398 H1055Q probably benign Het
Mcm6 T C 1: 128,349,052 N267S probably benign Het
Olfr262 T C 19: 12,241,502 D53G probably damaging Het
Phc3 T C 3: 30,929,869 I699V probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Pyroxd1 T C 6: 142,359,148 V367A probably benign Het
R3hdm1 G A 1: 128,231,405 R939H probably benign Het
Rag1 A T 2: 101,643,192 I535N probably damaging Het
Rhot1 T C 11: 80,246,021 C310R probably damaging Het
Tnrc6a G A 7: 123,184,251 V1481M probably benign Het
Vmn1r234 A T 17: 21,228,910 M29L probably benign Het
Vmn2r68 A G 7: 85,232,492 I460T probably damaging Het
Zfhx3 T A 8: 108,933,833 Y1240N probably damaging Het
Other mutations in Dlg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Dlg2 APN 7 91965645 missense probably damaging 1.00
IGL01111:Dlg2 APN 7 91449763 missense possibly damaging 0.84
IGL01122:Dlg2 APN 7 92442608 missense possibly damaging 0.58
IGL01296:Dlg2 APN 7 91940059 missense probably damaging 1.00
IGL02063:Dlg2 APN 7 91810476 splice site probably benign
IGL02233:Dlg2 APN 7 92444538 missense probably damaging 1.00
IGL02519:Dlg2 APN 7 91940115 missense possibly damaging 0.54
IGL02833:Dlg2 APN 7 92431127 missense probably damaging 1.00
IGL03166:Dlg2 APN 7 91900730 splice site probably benign
R0932:Dlg2 UTSW 7 92375637 missense probably damaging 1.00
R1129:Dlg2 UTSW 7 92431174 splice site probably null
R1245:Dlg2 UTSW 7 92442595 splice site probably benign
R1464:Dlg2 UTSW 7 91968198 missense probably damaging 1.00
R1464:Dlg2 UTSW 7 91968198 missense probably damaging 1.00
R1596:Dlg2 UTSW 7 92431051 missense probably damaging 0.99
R1650:Dlg2 UTSW 7 92431051 missense probably damaging 0.99
R1868:Dlg2 UTSW 7 92386952 nonsense probably null
R2006:Dlg2 UTSW 7 91965617 missense possibly damaging 0.95
R2026:Dlg2 UTSW 7 91965723 missense probably damaging 1.00
R2281:Dlg2 UTSW 7 92438041 missense probably damaging 1.00
R3721:Dlg2 UTSW 7 91711800 critical splice donor site probably null
R3722:Dlg2 UTSW 7 91711800 critical splice donor site probably null
R3793:Dlg2 UTSW 7 91810535 splice site probably benign
R4120:Dlg2 UTSW 7 91965638 missense probably damaging 1.00
R4444:Dlg2 UTSW 7 92088593 missense probably damaging 1.00
R4631:Dlg2 UTSW 7 92088614 missense probably damaging 1.00
R4672:Dlg2 UTSW 7 92286535 missense probably damaging 1.00
R4678:Dlg2 UTSW 7 92428580 missense possibly damaging 0.89
R4695:Dlg2 UTSW 7 92437962 splice site probably null
R5106:Dlg2 UTSW 7 92442686 missense probably damaging 0.99
R5355:Dlg2 UTSW 7 91449803 missense probably benign 0.41
R5385:Dlg2 UTSW 7 92088576 missense probably damaging 0.96
R5403:Dlg2 UTSW 7 92431002 missense probably damaging 1.00
R5504:Dlg2 UTSW 7 92442657 missense probably damaging 1.00
R5569:Dlg2 UTSW 7 91968180 missense probably benign 0.01
R5573:Dlg2 UTSW 7 91997324 splice site probably null
R5848:Dlg2 UTSW 7 92444527 missense probably benign 0.41
R5863:Dlg2 UTSW 7 91711779 missense probably benign 0.01
R5907:Dlg2 UTSW 7 91997371 intron probably benign
R6455:Dlg2 UTSW 7 92444508 splice site probably null
R6486:Dlg2 UTSW 7 91872374 critical splice acceptor site probably null
R6817:Dlg2 UTSW 7 91965664 missense probably benign 0.07
R7082:Dlg2 UTSW 7 90731984 missense probably benign
R7808:Dlg2 UTSW 7 92431055 missense probably benign 0.01
R7818:Dlg2 UTSW 7 91940017 missense probably damaging 0.99
R7908:Dlg2 UTSW 7 91900773 missense probably damaging 1.00
R7989:Dlg2 UTSW 7 91900773 missense probably damaging 1.00
RF004:Dlg2 UTSW 7 90852677 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACATGCTCAAAAGCTGGGCTTC -3'
(R):5'- TCGCACTGGCATTCCTATCTGAAAG -3'

Sequencing Primer
(F):5'- AAAAGCTGGGCTTCAGTCTTC -3'
(R):5'- AGCCTTTATGACAAACTGCTG -3'
Posted On2014-02-18