Incidental Mutation 'R1319:Bean1'
ID 157633
Institutional Source Beutler Lab
Gene Symbol Bean1
Ensembl Gene ENSMUSG00000031872
Gene Name brain expressed, associated with Nedd4, 1
Synonyms
MMRRC Submission 039385-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1319 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 104897110-104945730 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104943856 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 137 (I137T)
Ref Sequence ENSEMBL: ENSMUSP00000148283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093245] [ENSMUST00000164076] [ENSMUST00000167633] [ENSMUST00000171018] [ENSMUST00000212979] [ENSMUST00000213077]
AlphaFold Q9EQG5
Predicted Effect probably benign
Transcript: ENSMUST00000093245
AA Change: I242T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090931
Gene: ENSMUSG00000031872
AA Change: I242T

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 70 90 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164076
AA Change: I181T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132056
Gene: ENSMUSG00000031872
AA Change: I181T

DomainStartEndE-ValueType
low complexity region 156 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167633
AA Change: I242T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131530
Gene: ENSMUSG00000031872
AA Change: I242T

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 70 90 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171018
AA Change: I313T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129403
Gene: ENSMUSG00000031872
AA Change: I313T

DomainStartEndE-ValueType
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 104 124 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212672
Predicted Effect probably benign
Transcript: ENSMUST00000212979
AA Change: I313T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213077
AA Change: I137T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of several proteins that interact with NEDD4, a member of a family of ubiquitin-protein ligases. These proteins have PY motifs in common that bind to the WW domains of NEDD4. NEDD4 is developmentally regulated, and is highly expressed in embryonic tissues. Mutations in this gene (i.e., intronic insertions of >100 copies of pentanucleotide repeats including a (TGGAA)n sequence) are associated with spinocerebellar ataxia type 31. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null targeted allele are viable and fertile and exhibit no apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam28 T C 14: 68,846,578 (GRCm39) E745G probably benign Het
Adamts12 G T 15: 11,286,877 (GRCm39) K827N probably benign Het
Ang2 T C 14: 51,433,164 (GRCm39) T73A probably benign Het
Bbs10 T C 10: 111,134,735 (GRCm39) L51P probably damaging Het
Cimip1 A T 2: 173,369,716 (GRCm39) S77C probably damaging Het
Cttnbp2 T C 6: 18,434,629 (GRCm39) T410A probably benign Het
Cyp4a10 A C 4: 115,378,342 (GRCm39) I143L probably damaging Het
Dlg2 A T 7: 92,087,231 (GRCm39) Q788L probably damaging Het
Epha10 G A 4: 124,775,707 (GRCm39) V14I probably benign Het
Eprs1 G A 1: 185,117,159 (GRCm39) D401N probably damaging Het
Fam169a T C 13: 97,234,070 (GRCm39) V114A probably damaging Het
Fbn2 G A 18: 58,333,682 (GRCm39) P178S possibly damaging Het
Fcrl2 A C 3: 87,169,484 (GRCm39) probably null Het
Grm1 G T 10: 10,565,142 (GRCm39) H1055Q probably benign Het
Mcm6 T C 1: 128,276,789 (GRCm39) N267S probably benign Het
Or5an1c T C 19: 12,218,866 (GRCm39) D53G probably damaging Het
Phc3 T C 3: 30,984,018 (GRCm39) I699V probably damaging Het
Prl2c2 G C 13: 13,176,786 (GRCm39) T47R probably damaging Het
Pyroxd1 T C 6: 142,304,874 (GRCm39) V367A probably benign Het
R3hdm1 G A 1: 128,159,142 (GRCm39) R939H probably benign Het
Rag1 A T 2: 101,473,537 (GRCm39) I535N probably damaging Het
Rhot1 T C 11: 80,136,847 (GRCm39) C310R probably damaging Het
Tnrc6a G A 7: 122,783,474 (GRCm39) V1481M probably benign Het
Vmn1r234 A T 17: 21,449,172 (GRCm39) M29L probably benign Het
Vmn2r68 A G 7: 84,881,700 (GRCm39) I460T probably damaging Het
Zfhx3 T A 8: 109,660,465 (GRCm39) Y1240N probably damaging Het
Other mutations in Bean1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02016:Bean1 APN 8 104,937,550 (GRCm39) missense possibly damaging 0.90
R0135:Bean1 UTSW 8 104,943,807 (GRCm39) missense probably damaging 1.00
R0490:Bean1 UTSW 8 104,941,660 (GRCm39) missense possibly damaging 0.76
R1920:Bean1 UTSW 8 104,937,742 (GRCm39) missense possibly damaging 0.92
R2513:Bean1 UTSW 8 104,908,643 (GRCm39) missense probably benign 0.04
R3980:Bean1 UTSW 8 104,937,730 (GRCm39) missense possibly damaging 0.92
R4209:Bean1 UTSW 8 104,940,566 (GRCm39) start codon destroyed probably null 0.04
R4369:Bean1 UTSW 8 104,943,742 (GRCm39) missense probably damaging 1.00
R4516:Bean1 UTSW 8 104,941,786 (GRCm39) missense probably damaging 1.00
R4542:Bean1 UTSW 8 104,937,591 (GRCm39) missense probably damaging 1.00
R4663:Bean1 UTSW 8 104,937,799 (GRCm39) missense probably damaging 1.00
R4962:Bean1 UTSW 8 104,943,606 (GRCm39) missense probably damaging 1.00
R5221:Bean1 UTSW 8 104,941,784 (GRCm39) missense probably damaging 1.00
R6288:Bean1 UTSW 8 104,937,622 (GRCm39) missense probably damaging 1.00
R6588:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R6615:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R6994:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R7359:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R7451:Bean1 UTSW 8 104,940,628 (GRCm39) missense probably benign 0.01
R7454:Bean1 UTSW 8 104,937,658 (GRCm39) missense probably damaging 1.00
R7473:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R7537:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R7826:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8034:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8418:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8789:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8885:Bean1 UTSW 8 104,908,752 (GRCm39) critical splice donor site probably null
R8888:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8892:Bean1 UTSW 8 104,943,610 (GRCm39) missense probably damaging 1.00
R8896:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8992:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9015:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9113:Bean1 UTSW 8 104,940,557 (GRCm39) missense probably benign 0.00
R9122:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9135:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9151:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9255:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9340:Bean1 UTSW 8 104,908,739 (GRCm39) missense probably damaging 0.99
R9363:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9417:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9537:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9566:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9731:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
RF054:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CACAGCTATGAGGAATGCATGGGAC -3'
(R):5'- TTATGGCAGGAAGCTGACCAAGC -3'

Sequencing Primer
(F):5'- TATGTCCCCACGGATGCAC -3'
(R):5'- AGCTGACCAAGCAGTCTCTG -3'
Posted On 2014-02-18